CALM1 (NM_006888) Human Untagged Clone

CAT#: SC115829

CALM1 (untagged)-Human calmodulin 1 (phosphorylase kinase, delta) (CALM1), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CALM1 (NM_006888) Human Untagged Clone
Symbol CALM1
Synonyms CALML2; caM; CAMI; CPVT4; DD132; LQT14; PHKD
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC115829 sequence for NM_006888 edited (data generated by NextGen Sequencing)
ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTT
GATAAAGATGGCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTG
GGTCAGAACCCAACAGAAGCTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGT
AATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACA
GATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTAT
ATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAA
GAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAA
GAATTCGTACAGATGATGACTGCAAAATGA

Clone variation with respect to NM_006888.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006888 unedited
TGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGTGGACGCCGTGCCGTTACT
CGTAGTCAGGCGGCGGCGCAGGCGGCGGCGGCGGCATAGCGCACAGCGCGCCTTAGCAGC
AGCAGCAGCAGCAGCAGCATCGGAGGTACCCCCGCCGTCGCAGCCCCCGCGCTGGTGCAG
CCACCCTCGCTCCCTCTGCTCTTCCTCCCTTCGCTCGCACCATGGCTGATCAGCTGACCG
AAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTTGATAAAGATGGCGATGGCA
CCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTGGGTCAGAACCCAACAGAAG
CTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGTAATGGCACCATTGACTTCC
CCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACAGATAGTGAAGAAGAAATCC
GTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTATATCAGTGCAGCAGAACTAC
GTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAAGAAGTAGATGAAATGATCA
GAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAAGAATTCGTACAGATGATGA
CTGCAAAATGAAGACCTACTTTCAACTCCTTTTTTCCCCCCTCTAGAAGAATCAAATTGA
ATCTTTTACTTTACCTCTTGCAAAAAAAGAAAAAGAANAAGTTCATTTATTCATTCTGTT
TCTATATAGCAAACTGATGTCAAAGTACCTTCTGTCCACAACACAAATCTGCAGNATGGG
TGGGNGGGCCCTGTCCCTAAGATCAGCTCACATCAGTTTACATATAATACTGGGACTACC
TTATGAAAAGGATC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006888 unedited
GCTATGGACCCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTGAGTTAATG
GTCTTTTTATTGGAAAAAAAAAAAAAAAGACTAGCATTTACAACTTGGAATGGACGTAAA
CTGTAATTTCTTTGAACAGCAATGTTGATGGTTGTGCTGAAGTCCACAGCCACAGCCTAC
TCTGCCGGCTCCAAGTCATGGTTCAAAAGGTTTTAAAAACAGAGAGTCCAAAGATGCTCC
CTTGGTAAATGTTTCTTATTAAAAATTTGTGTGAACAGTGACAGCCTGACACCTGTTTCA
CTCTAGAACAATGCAGACAACGCTAAACCAACATACACGGGCATGCCACCAGGGTGTGTC
ATCGTCACCATGGGTCGGAGCACACGAAGTACAAGAGGACCATCCTACCAGTGGGGCCAC
GTCTCAACGGTTTATCCTTCACCCATTTTTCTGCACGTCATCCTGAGGTAAACCAATTTT
AAATGTGTTTGTTTTCAGTAAACCAGCTATGACAATTTATACTAAACAAATTGAACTAGA
ACCCATTTGAATAGGTTTTGAATTTGTTTTTTCATTTTTCATTTTTAATACAAAGGCCTG
ACTGTGCTCAATCGTCAAGCTGCATGCATGAAAAACTGGCCAGCCCAAACAGTGTATTAA
TCATTAGCAAATGGAACTTTAAGGAGTCCTTATCATTAAGGTAGTACAAGTATTTATATT
GTAAAACTGATGTGTAGCTTGATCTTTANGGGACAGGACCACCAACCAATACATGCAGAT
TTTGTGTGTGTGGACAGAAGGTACTTTTGACATTCAGNTNTGCTTATAGAAACAGATGAT
AAATGACTTTTTTCTTTTTCTTTTTTGCAGAGGTAGTAAAGATCATTTGATTCTCTAAGC
GGAAAAGAGTGAAAGAGTCTATTTGCAGCATATCTGACAATCTCTANTGACTG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006888
ORF Size 450 bp
Insert Size 1500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006888.2, NP_008819
RefSeq Size 3718
RefSeq ORF 450
Locus ID 801
Cytogenetics 14q32.11
Domains EFh
Protein Families Druggable Genome
Protein Pathways Calcium signaling pathway, Phosphatidylinositol signaling system, Oocyte meiosis, Vascular smooth muscle contraction, Long-term potentiation, Neurotrophin signaling pathway, Olfactory transduction, Insulin signaling pathway, GnRH signaling pathway, Melanogenesis, Alzheimer's disease, Glioma
Gene Summary This gene encodes a member of the EF-hand calcium-binding protein family. It is one of three genes which encode an identical calcium binding protein which is one of the four subunits of phosphorylase kinase. Two pseudogenes have been identified on chromosome 7 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations