SF2 (SRSF1) (NM_006924) Human Untagged Clone

SKU
SC115786
SRSF1 (untagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1
$450.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SF2
Synonyms ASF; SF2; SF2p33; SFRS1; SRp30a
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_006924 edited
ATGTCGGGAGGTGGTGTGATTCGTGGCCCCGCAGGGAACAACGATTGCCGCATCTACGTG
GGTAACTTACCTCCAGACATCCGAACCAAGGACATTGAGGACGTGTTCTACAAATACGGC
GCTATCCGCGACATCGACCTCAAGAATCGCCGCGGGGGACCGCCCTTCGCCTTCGTTGAG
TTCGAGGACCCGCGAGACGCGGAAGACGCGGTGTATGGTCGCGACGGCTATGATTACGAT
GGGTACCGTCTGCGGGTGGAGTTTCCTCGAAGCGGCCGTGGAACAGGCCGAGGCGGCGGC
GGGGGTGGAGGTGGCGGAGCTCCCCGAGGTCGCTATGGCCCCCCATCCAGGCGGTCTGAA
AACAGAGTGGTTGTCTCTGGACTGCCTCCAAGTGGAAGTTGGCAGGATTTAAAGGATCAC
ATGCGTGAAGCAGGTGATGTATGTTATGCTGATGTTTACCGAGATGGCACTGGTGTCGTG
GAGTTTGTACGGAAAGAAGATATGACCTATGCAGTTCGAAAACTGGATAACACTAAGTTT
AGATCTCATGAGGGAGAAACTGCCTACATCCGGGTTAAAGTTGATGGGCCCAGAAGTCCA
AGTTATGGAAGATCTCGATCTCGAAGCCGTAGTCGTAGCAGAAGCCGTAGCAGAAGCAAC
AGCAGGAGTCGCAGTTACTCCCCAAGGAGAAGCAGAGGATCACCACGCTATTCTCCCCGT
CATAGCAGATCTCGCTCTCGTACATAA
Restriction Sites ECoRI-NOT
ACCN NM_006924
Insert Size 2000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_006924.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006924.1, NP_008855.1
RefSeq Size 1428 bp
RefSeq ORF 747 bp
Locus ID 6426
UniProt ID Q07955
Cytogenetics 17q22
Domains RRM
Protein Families Stem cell - Pluripotency
Protein Pathways Spliceosome
Summary This gene encodes a member of the arginine/serine-rich splicing factor protein family. The encoded protein can either activate or repress splicing, depending on its phosphorylation state and its interaction partners. Multiple transcript variants have been found for this gene. There is a pseudogene of this gene on chromosome 13. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (1) encodes the longer isoform (1, also known as ASF-1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:SF2 (SRSF1) (NM_006924) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201636 SRSF1 (Myc-DDK-tagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1 10 ug
$450.00
RC201636L1 Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC201636L2 Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1, mGFP tagged 10 ug
$750.00
RC201636L3 Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC201636L4 Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1, mGFP tagged 10 ug
$750.00
RG201636 SRSF1 (tGFP-tagged) - Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1 10 ug
$489.00 MSRP $650.00 MSRP $650.00
SC323930 SRSF1 (untagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.