LSM6 (NM_007080) Human Untagged Clone

SKU
SC115712
LSM6 (untagged)-Human LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM6)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LSM6
Synonyms YDR378C
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC115712 sequence for NM_007080 edited (data generated by NextGen Sequencing)
ATGAGTCTTCGGAAGCAAACCCCTAGTGACTTCTTAAAGCAAATCATCGGACGACCAGTT
GTGGTAAAATTAAATTCTGGAGTGGATTATCGAGGGGTCCTGGCTTGCCTGGATGGCTAC
ATGAATATAGCCCTGGAGCAGACAGAAGAATATGTAAATGGACAACTGAAGAATAAGTAT
GGGGATGCATTTATCCGAGGAAACAATGTGTTGTACATCAGTACACAGAAGAGACGGATG
TGA

Clone variation with respect to NM_007080.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_007080 unedited
NNCCTGTTCAAATTTGTATACGACTCCTATAGGGCGGCCGCGATTCGGCACGAGGGCCGC
GTCCAAGCTCTCCGCGCATGGAATGGCTGGGAGAGGTCTGATGGTGGGCGCCGGGACCGC
CCTCAGCGAGGCGCCTAGACTGCGCGGAGAGGAGCGGCACCGTCCCGGCTCCTACCGAGT
TGGCGTCCGAGATCAATTCAGGTTGTTGAAGTTCCCCAGGGAGCCCCGACGCTAATCCCA
AGATTCGGCGGGAAAGCGGATCCCGAACCCAGGCCTAGGCTTCGCCTGTCTTCCAGGAGG
GCTTCAGGGAATTGCGAACCCTCTCCTACATCGGGGTGGCTGCGCCTGACCACAGGAATT
AAAGGCTGGACTCGCCTGTCTTACCAAGTTGTCAGGTCGAGGAACCCGATTGTATGGTCT
TAAGTCCTATCGCCCAAGGTTTTCTGTGCGTATGCGTGTCCGCACACCTGCATAGCAGGC
ATTTTTAAGGATTGTTAAAATGAGTCTTCGGAAGCAAACCCCTAGTGACTTCTTAAAGCA
AATCATCGGACGACCAGTTGTGGTAAAATTAAATTCTGGAGTGGATTATCGAGGGGTCCT
GGCTTGCCTGGATGGCTACATGAATATAGCCCTGGAGCAGACAGAAGAATATGTAAATGG
ACAACTGAAGAATAAGTATGGGGATGCATTTATCCGAGGAAACAATGTGTTGTACATCAG
TACACAGAAGAGACGGATGTGAAGACACCAAGAGAGCAACGCTNTTCATAGTTGGATATA
TTTTTTTATGAATTTTTTCTAATTTTTGCTTCTTTTGTGATACAATTTGTCCCTCTTTTA
TAATAGTTGGTGGATTNTTCACTGACCATGTGAGTAGATAAATGG
Restriction Sites NotI-NotI
ACCN NM_007080
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007080.1, NP_009011.1
RefSeq Size 596 bp
RefSeq ORF 243 bp
Locus ID 11157
UniProt ID P62312
Cytogenetics 4q31.22
Domains Sm
Protein Families Stem cell - Pluripotency
Protein Pathways RNA degradation, Spliceosome
Summary Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Write Your Own Review
You're reviewing:LSM6 (NM_007080) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202373 LSM6 (Myc-DDK-tagged)-Human LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM6) 10 ug
$150.00
RC202373L3 Lenti ORF clone of Human LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM6), Myc-DDK-tagged 10 ug
$450.00
RC202373L4 Lenti ORF clone of Human LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM6), mGFP tagged 10 ug
$450.00
RG202373 LSM6 (tGFP-tagged) - Human LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM6) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.