STK38 (NM_007271) Human Untagged Clone

CAT#: SC115629

Reviews ()
Write a review

STK38 (untagged)-Human serine/threonine kinase 38 (STK38)



  "NM_007271" in other vectors (7)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product images

Other products for "STK38"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol STK38
Synonyms NDR; NDR1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_007271 edited
ATGGCAATGACAGGCTCAACACCTTGCTCATCCATGAGTAACCACACAAAGGAAAGGGTG
ACAATGACCAAAGTGACACTGGAGAATTTTTATAGCAACCTTATCGCTCAACATGAAGAA
CGAGAAATGAGACAAAAGAAGTTAGAAAAGGTGATGGAAGAAGAAGGCCTAAAAGATGAG
GAGAAACGACTCCGGAGATCAGCACATGCTCGGAAGGAAACAGAGTTTCTTCGTTTGAAG
AGAACAAGACTTGGATTGGAAGATTTTGAGTCCTTAAAAGTAATAGGCAGAGGAGCATTT
GGTGAGGTACGGCTTGTTCAGAAGAAAGATACGGGACATGTGTATGCAATGAAAATACTC
CGTAAAGCAGATATGCTTGAAAAAGAGCAGGTTGGCCACATTCGTGCGGAGCGTGACATT
CTAGTGGAGGCAGACAGTTTGTGGGTTGTGAAAATGTTCTATAGTTTTCAGGATAAGCTA
AACCTCTACCTAATCATGGAGTTCCTGCCTGGAGGGGACATGATGACCTTGTTGATGAAA
AAAGACACTCTGACAGAAGAGGAGACTCAGTTTTATATAGCAGAAACAGTATTAGCCATA
GACTCTATTCACCAACTTGGATTCATCCACAGAGACATCAAACCAGACAACCTTCTTTTG
GACAGCAAGGGCCATGTGAAACTTTCTGACTTTGGTCTTTGCACAGGACTGAAAAAAGCA
CATAGGACAGAATTTTATAGGAATCTGAACCACAGCCTCCCCAGTGATTTCACTTTCCAG
AACATGAATTCCAAAAGGAAAGCAGAAACCTGGAAAAGAAATAGACGTCAGCTAGCCTTC
TCCACAGTAGGCACTCCTGACTACATTGCTCCTGAGGTGTTCATGCAGACCGGGTACAAC
AAGCTCTGTGATTGGTGGTCGCTTGGGGTGATCATGTATGAGATGCTCATCGGCTACCCA
CCTTTCTGTTCTGAGACCCCTCAAGAGACATATAAGAAGGTGATGAACTGGAAAGAAACT
TTGACTTTTCCTCCAGAAGTTCCCATCTCTGAGAAAGCCAAGGATCTAATTTTGAGGTTC
TGCTGTGAATGGGAACATAGAATTGGAGCTCCTGGAGTTGAGGAAATAAAAAGTAACTCT
TTTTTTGAAGGCGTTGACTGGGAACATATCAGAGAGAGACCTGCTGCAATATCTATTGAA
ATCAAAAGCATTGATGATACCTCAAACTTCGATGAGTTTCCAGAATCTGATATTCTTAAG
CCAACAGTGGCCACAAGTAATCATCCTGAGACTGACTACAAGAACAAAGACTGGGTCTTC
ATCAATTACACGTACAAGCGCTTTGAGGGCCTGACTGCAAGGGGGGCAATACCTTCCTAC
ATGAAAGCAGCAAAATAG
>OriGene 5' read for NM_007271 unedited
TAAGGTCAATTTTGTAAACCACTCCTATAGGCGGCCGCGACATCGGCACGAGTGCTGGGC
CTCTGCCATGGCAATGACAGGCTCAACACCTTGCTCATCCATGAGTAACCACACAAAGGA
AAGGGTGACAATGACCAAAGTGACACTGNGAGAATTTTTATAGCAACCTTATCGCTCAAC
ATGAAGAACGAGAAATGAGACAAAAGAAGTTAGAAAAGGTGATGGAAGAAGAAGGCCTAA
AAGATGAGGAGAAACGACTCCGGAGATCAGCACATGCTCGGAAGGAAACAGAGTTTCTTC
GTTTGAAGAGAACAAGACTTGGATTGGAAGATTTTGAGTCCTTAAAAGTAATAGGCAGAG
GAGCATTTGGTGAGGTACGGCTTGTTCAGAAGAAAGATACGGGACATGTGTATGCAATGA
AAATACTCCGTAAAGCAGATATGCTTGAAAAAGAGCAGGTTGGCCACATTCGTGCGGAGC
GTGACATTCTAGTGGAGGCAGACAGTTTGTGGGTTGTGAAAATGTTCTATAGTTTTCAGG
ATAAGCTAAACCTCTACCTAATCATGGAGTTCCTGCCTGGAGGGGACATGATGACCTTGT
TGATGAAAAAAGACACTCTGACAGAAGAGGAGACTCAGTTTTATATAGCAGAAACAGTAT
TAGCCATAGACTCTATTCACCAACTTGGATTCATCCACAGAGACATCAAACCAGACAACC
TTCTTTTGGACAGCAAGGGCCATGTGAAACTTTCTGACTTTGGTCTTTGCACAGGACTGA
NAAAAGCACATAGACAGAATTTTATAGGAATCTGAACCACAGCCTCCCCAGTGATTTCAC
TTTCCAGAACATGAATTCCAAAAGNAAAGCAGAACCTGGAAAAGAATAGACGTCAGCTAG
>OriGene 3' read for NM_007271 unedited
CCCAAATCGGGGGCCGTTTCATCTTTGTTTAAAGTTAAAAGTGGGCATTTTCCCCTGAAA
CAAATCATCCCCTGGCCACTCCCCAACACAAAGACTCTCCCAACACCGCAGTTCCTTCTC
TTTACCCAGGCTTACCACACATTCTTGCAAAACACACAGGAGTCAACACCCCAACTATTT
GGTAATACAAAGAGACTACAAAGTCACACAAAAGAATCTCATTTACTTCCTTTTCACTAG
CAGGCTATGAATGAAAGACTGAGAGGCAAACACATCACCTTCATCCAGAGTTGACACTTC
CCTAACCTTTTTTCTTCCTCTAAGAGGTTAAAATCCAAAGTAGTTTCACTGACAACTGTA
ACTCTGATATTCCATTTTTCTCTTCTGAATGGCTAAGCTAGGACATACTTTCCTTTCAAA
GCTGATCTTCAGAACCTCAAGACTGGCAGAAAGCAGGCTCCCAGCTGCAGCTCGGCCACA
ATACTTTGCAACAGGCAAAGTTCCCACATAGGTGCAAATGATGCTTTAAGAGTTATCAAA
ACTTTTTAAAAAATAATGCATTAATATGGAGCCTCCACATTTTTCTGACGAAATTCCTCT
AAAGGTGGTGGCAGCTGTGAAACAGAAGGCACTTTGTGCTAAAATTCAGAGGGTCTCTCA
AGAGAGAACGCCACAGCAGAGAGACCCAATCCGCCTAAGTTGCAGGCGACCCTTTAAGGT
GGGGAGGAATATCCCCCAGGAAGCATCTGCNAAGAAAAAATTGAATCATGATTCCCAGGC
AAAATGGCTTAAGTTGGGAGAAAAGAACTCCCAGAGGAAAGACAAACATGGCTGTCCCAG
GACTGAGAATGAGCTTTCAAAGACTTGTCAGCTGGCCCTGGCTTCTATTGGGCTGT
Restriction Sites NotI-NotI     
ACCN NM_007271
Insert Size 3500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007271.2, NP_009202.1
RefSeq Size 3593 bp
RefSeq ORF 1398 bp
Locus ID 11329
UniProt ID Q15208
Cytogenetics 6p21.31
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Gene Summary This gene encodes a member of the AGC serine/threonine kinase family of proteins. The kinase activity of this protein is regulated by autophosphorylation and phosphorylation by other upstream kinases. This protein has been shown to function in the cell cycle and apoptosis. This protein has also been found to regulate the protein stability and transcriptional activity of the MYC oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.