MAFF (NM_012323) Human Untagged Clone

SKU
SC115453
MAFF (untagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), transcript variant 1
$225.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAFF
Synonyms hMafF; U-MAF
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_012323, the custom clone sequence may differ by one or more nucleotides


ATGTCTGTGGATCCCCTATCCAGCAAAGCTCTAAAGATCAAGCGAGAGCTGAGCGAGAACACGCCGCACC
TGTCGGACGAGGCGCTGATGGGGCTGTCGGTGCGCGAGCTGAACCGGCATCTGCGCGGGCTCTCCGCCGA
GGAGGTGACACGGCTCAAGCAGCGGCGCCGCACACTCAAAAACCGTGGCTACGCCGCCAGCTGCCGCGTG
AAGCGCGTGTGCCAGAAGGAGGAGCTGCAGAAGCAGAAGTCGGAGCTGGAGCGCGAGGTGGACAAGCTGG
CGCGCGAGAACGCCGCCATGCGCCTGGAGCTCGACGCGCTGCGCGGCAAGTGCGAGGCGCTGCAGGGCTT
CGCGCGCTCCGTGGCCGCCGCCCGCGGGCCCGCCACGCTCGTGGCGCCGGCCAGCGTCATCACCATCGTC
AAGTCCACCCCGGGCTCGGGGTCTGGCCCCGCCCACGGCCCGGACCCCGCCCACGGCCCGGCCTCCTGCT
CCTAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_012323 unedited
NCGTCACCATTTGTATACGACTCATATAGGCGGCCGCGAATTCGGCACGAGGCGACCTGC
GGCTCAGAGCGGAGGGGAGACTGACCGGAGCGCGGATCGGGACAGCGGCCGGGACAGCGG
CGAGACGCGCGTGTGTGAGCGCGCCGGACCAAGCGGGCCCAGAAGCGGGTCTGCAGCCCA
GAGGGCACCTTCTGCAAACATGTCTGTGGATCCCCTATCCAGCAAAGCTCTAAAGATCAA
GCGAGAGCTGAGCGAGAACACGCCGCACCTGTCGGACGAGGCGCTGATGGGGCTGTCGGT
GCGCGAGCTGAACCGGCATCTGCGCGGGCTCTCCGCCGAGGAGGTGACACGGCTCAAGCA
GCGGCGCCGCACACTCAAAAACCGTGGCTACGCCGCCAGCTGCCGCGTGAAGCGCGTGTG
CCAGAAGGAGGAGCTGCAGAAGCAGAAGTCGGAGCTGGAGCGCGAGGTGGACAAGCTGGC
GCGCGAGAACGCCGCCATGCGCCTGGAGCTCGACGCGCTGCGCGGCAAGTGCGAGGCGCT
GCAGGGCTTCGCGCGCTCCGTGGCCGCCGCCCGCGGGCCCGCCACGCTCGTGGCGCCGGC
CAGCGTCATCACCATCGTCAAGTCCACCCCGGGCTCGGGGGTCTGGCCCCGCCCACGGGC
CGGACCCCGCCCACGGCCCGGCCTCCTGTNNCTAGTGCCCGCCCNCGCCATGCCTCAGCC
ACGCCCCTCCGGCCTCAGCTCCCTCCCCAAAGTGCCTGAGCGCCGCCTCTGTGCCCAGGT
CCCATTTCTCTGCAGCACTGGCCCCCTTGGTGCACACACATTCCCCTTCGTGGGGCCCTG
TCTTNCTCTTTGCAGCCCCCAAACTGGNGACCGAATGACCCTGNGAAGGNNGAANNTGNN
GTAGTNGNNGATGGGGGCANAGGTCTGGATCTGGGATCGNCCTTGGNNCTGAAGTTACCT
TNNTN
Restriction Sites NotI-NotI
ACCN NM_012323
Insert Size 2400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012323.2, NP_036455.1
RefSeq Size 2382 bp
RefSeq ORF 495 bp
Locus ID 23764
UniProt ID Q9ULX9
Cytogenetics 22q13.1
Domains BRLZ, bZIP_Maf
Protein Families Druggable Genome, Transcription Factors
Summary The protein encoded by this gene is a basic leucine zipper (bZIP) transcription factor that lacks a transactivation domain. It is known to bind the US-2 DNA element in the promoter of the oxytocin receptor (OTR) gene and most likely heterodimerizes with other leucine zipper-containing proteins to enhance expression of the OTR gene during term pregnancy. The encoded protein can also form homodimers, and since it lacks a transactivation domain, the homodimer may act as a repressor of transcription. This gene may also be involved in the cellular stress response. Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 3. Variants 1, 3, and 4 encode the same isoform (a).
Write Your Own Review
You're reviewing:MAFF (NM_012323) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215609 MAFF (Myc-DDK-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), transcript variant 1 10 ug
$240.00
RC215609L3 Lenti-ORF clone of MAFF (Myc-DDK-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), transcript variant 1 10 ug
$540.00
RC215609L4 Lenti-ORF clone of MAFF (mGFP-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), transcript variant 1 10 ug
$540.00
RG215609 MAFF (tGFP-tagged) - Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), transcript variant 1 10 ug
$440.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.