Neurokinin B (TAC3) (NM_013251) Human Untagged Clone

SKU
SC115350
TAC3 (untagged)-Human tachykinin 3 (TAC3), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Neurokinin B
Synonyms HH10; LncZBTB39; NK3; NKB; NKNB; PRO1155; ZNEUROK1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_013251 edited
ATGAGGATCATGCTGCTATTCACAGCCATCCTGGCCTTCAGCCTAGCTCAGAGCTTTGGG
GCTGTCTGTAAGGAGCCACAGGAGGAGGTGGTTCCTGGCGGGGGCCGCAGCAAGAGGGAT
CCAGATCTCTACCAGCTGCTCCAGAGACTCTTCAAAAGCCACTCATCTCTGGAGGGATTG
CTCAAAGCCCTGAGCCAGGCTAGCACAGATCCTAAGGAATCAACATCTCCCGAGAAACGT
GACATGCATGACTTCTTTGTGGGACTTATGGGCAAGAGGAGCGTCCAGCCAGACTCTCCT
ACGGATGTGAATCAAGAGAACGTCCCCAGCTTTGGCATCCTCAAGTATCCCCCGAGAGCA
GAATAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_013251 unedited
CACCAGCTCCACTCGGTTTCTCTCTTTGCAGGAGCACCGGCAGCACCAGTGTGTGAGGGG
AGCAGGCAGCGGTCCTAGCCAGTTCCTTGATCCTGCCAGACCACCCAGCCCCCGGCACAG
AGCTGCTCCACAGGCACCATGAGGATCATGCTGCTATTCACAGCCATCCTGGCCTTCAGC
CTAGCTCAGAGCTTTGGGGCTGTCTGTAAGGAGCCACAGGAGGAGGTGGTTCCTGGCGGG
GGCCGCAGCAAGAGGGATCCAGATCTCTACCAGCTGCTCCAGAGACTCTTCAAAAGCCAC
TCATCTCTGGAGGGATTGCTCAAAGCCCTGAGCCAGGCTAGCACAGATCCTAAGGAATCA
ACATCTCCCGAGAAACGTGACATGCATGACTTCTTTGTGGGACTTATGGGCAAGAGGAGC
GTCCAGCCAGACTCTCCTACGGATGTGAATCAAGAGAACGTCCCCAGCTTTGGCATCCTC
AAGTATCCCCCGAGAGCAGAATAGGTACTCCACTTCCGGACTCCTGGACTGCATTAGGAA
GACCTCTTTCCCTGTCCCAATCCCCAGGTGCGCACGCCTCCTGTTACCCTTTCTCTTCCC
TGTTCTTGTACATNTCTTGTGCTTTGACTCCTTCTCCATCTTTTCTACCTGACCCTGGTG
TGGAAACTGCATAGTGAATATCCCCAACCCCAATGGGCATTGACTGTAGAATACCCTAGA
GTTCCTGTAGTGTCCTACATTAAAAATATAATGTCTCTCTCTATT
Restriction Sites NotI-NotI
ACCN NM_013251
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013251.2, NP_037383.1
RefSeq Size 832 bp
RefSeq ORF 366 bp
Locus ID 6866
UniProt ID Q9UHF0
Cytogenetics 12q13.3
Domains Neurokinin_B
Protein Families Druggable Genome, Secreted Protein
Summary This gene encodes a member of the tachykinin family of secreted neuropeptides. The encoded preproprotein is proteolytically processed to generate the mature peptide, which is primarily expressed in the central and peripheral nervous systems and functions as a neurotransmitter. This peptide is the ligand for the neurokinin-3 receptor. This protein is also expressed in the outer syncytiotrophoblast of the placenta and may be associated with pregnancy-induced hypertension and pre-eclampsia. Mutations in this gene are associated with normosmic hypogonadotropic hypogonadism. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1).
Write Your Own Review
You're reviewing:Neurokinin B (TAC3) (NM_013251) Human Untagged Clone
Your Rating
SKU Description Size Price
RC205666 TAC3 (Myc-DDK-tagged)-Human tachykinin 3 (TAC3), transcript variant 1 10 ug
$150.00
RC205666L3 Lenti ORF clone of Human tachykinin 3 (TAC3), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC205666L4 Lenti ORF clone of Human tachykinin 3 (TAC3), transcript variant 1, mGFP tagged 10 ug
$450.00
RG205666 TAC3 (tGFP-tagged) - Human tachykinin 3 (TAC3), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.