Neurokinin B (TAC3) (NM_013251) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Neurokinin B |
Synonyms | HH10; LncZBTB39; NK3; NKB; NKNB; PRO1155; ZNEUROK1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_013251 edited
ATGAGGATCATGCTGCTATTCACAGCCATCCTGGCCTTCAGCCTAGCTCAGAGCTTTGGG GCTGTCTGTAAGGAGCCACAGGAGGAGGTGGTTCCTGGCGGGGGCCGCAGCAAGAGGGAT CCAGATCTCTACCAGCTGCTCCAGAGACTCTTCAAAAGCCACTCATCTCTGGAGGGATTG CTCAAAGCCCTGAGCCAGGCTAGCACAGATCCTAAGGAATCAACATCTCCCGAGAAACGT GACATGCATGACTTCTTTGTGGGACTTATGGGCAAGAGGAGCGTCCAGCCAGACTCTCCT ACGGATGTGAATCAAGAGAACGTCCCCAGCTTTGGCATCCTCAAGTATCCCCCGAGAGCA GAATAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_013251 unedited
CACCAGCTCCACTCGGTTTCTCTCTTTGCAGGAGCACCGGCAGCACCAGTGTGTGAGGGG AGCAGGCAGCGGTCCTAGCCAGTTCCTTGATCCTGCCAGACCACCCAGCCCCCGGCACAG AGCTGCTCCACAGGCACCATGAGGATCATGCTGCTATTCACAGCCATCCTGGCCTTCAGC CTAGCTCAGAGCTTTGGGGCTGTCTGTAAGGAGCCACAGGAGGAGGTGGTTCCTGGCGGG GGCCGCAGCAAGAGGGATCCAGATCTCTACCAGCTGCTCCAGAGACTCTTCAAAAGCCAC TCATCTCTGGAGGGATTGCTCAAAGCCCTGAGCCAGGCTAGCACAGATCCTAAGGAATCA ACATCTCCCGAGAAACGTGACATGCATGACTTCTTTGTGGGACTTATGGGCAAGAGGAGC GTCCAGCCAGACTCTCCTACGGATGTGAATCAAGAGAACGTCCCCAGCTTTGGCATCCTC AAGTATCCCCCGAGAGCAGAATAGGTACTCCACTTCCGGACTCCTGGACTGCATTAGGAA GACCTCTTTCCCTGTCCCAATCCCCAGGTGCGCACGCCTCCTGTTACCCTTTCTCTTCCC TGTTCTTGTACATNTCTTGTGCTTTGACTCCTTCTCCATCTTTTCTACCTGACCCTGGTG TGGAAACTGCATAGTGAATATCCCCAACCCCAATGGGCATTGACTGTAGAATACCCTAGA GTTCCTGTAGTGTCCTACATTAAAAATATAATGTCTCTCTCTATT |
Restriction Sites | NotI-NotI |
ACCN | NM_013251 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_013251.2, NP_037383.1 |
RefSeq Size | 832 bp |
RefSeq ORF | 366 bp |
Locus ID | 6866 |
UniProt ID | Q9UHF0 |
Cytogenetics | 12q13.3 |
Domains | Neurokinin_B |
Protein Families | Druggable Genome, Secreted Protein |
Summary | This gene encodes a member of the tachykinin family of secreted neuropeptides. The encoded preproprotein is proteolytically processed to generate the mature peptide, which is primarily expressed in the central and peripheral nervous systems and functions as a neurotransmitter. This peptide is the ligand for the neurokinin-3 receptor. This protein is also expressed in the outer syncytiotrophoblast of the placenta and may be associated with pregnancy-induced hypertension and pre-eclampsia. Mutations in this gene are associated with normosmic hypogonadotropic hypogonadism. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC205666 | TAC3 (Myc-DDK-tagged)-Human tachykinin 3 (TAC3), transcript variant 1 | 10 ug |
$150.00
|
|
RC205666L3 | Lenti ORF clone of Human tachykinin 3 (TAC3), transcript variant 1, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC205666L4 | Lenti ORF clone of Human tachykinin 3 (TAC3), transcript variant 1, mGFP tagged | 10 ug |
$450.00
|
|
RG205666 | TAC3 (tGFP-tagged) - Human tachykinin 3 (TAC3), transcript variant 1 | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.