DNAJC15 (NM_013238) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | DNAJC15 |
Synonyms | DNAJD1; HSD18; MCJ |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF within SC115339 sequence for NM_013238 edited (data generated by NextGen Sequencing)
ATGGCTGCCCGTGGTGTCATCGCTCCAGTTGGCGAGAGTTTGCGCTACGCTGAGTACTTG CAGCCCTCGGCCAAACGGCCAGACGCCGACGTCGACCAGCAGAGACTGGTAAGAAGTTTG ATAGCTGTAGGCCTGGGTGTTGCAGCTCTTGCATTTGCAGGTCGCTACGCATTTCGGATC TGGAAACCTCTAGAACAAGTTATCACAGAAACTGCAAAGAAGATTTCAACTCCTAGCTTT TCATCCTACTATAAAGGAGGATTTGAACAGAAAATGAGTAGGCGAGAAGCTGGTCTTATT TTAGGTGTAAGCCCATCTGCTGGCAAGGCTAAGATTAGAACAGCTCATAGGAGAGTCATG ATTTTGAATCACCCAGATAAAGGTGGATCTCCTTACGTAGCAGCCAAAATAAATGAAGCA AAAGACTTGCTAGAAACAACCACCAAACATTGA Clone variation with respect to NM_013238.2 132 a=>c |
Restriction Sites | Please inquire |
ACCN | NM_013238 |
Insert Size | 2500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_013238.2, NP_037370.2 |
RefSeq Size | 2792 bp |
RefSeq ORF | 453 bp |
Locus ID | 29103 |
UniProt ID | Q9Y5T4 |
Cytogenetics | 13q14.11 |
Domains | DnaJ |
Protein Families | Transmembrane |
Summary | Negative regulator of the mitochondrial respiratory chain. Prevents mitochondrial hyperpolarization state and restricts mitochondrial generation of ATP (By similarity). Acts as an import component of the TIM23 translocase complex. Stimulates the ATPase activity of HSPA9.[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC210567 | DNAJC15 (Myc-DDK-tagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15) | 10 ug |
$150.00
|
|
RC210567L1 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC210567L2 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), mGFP tagged | 10 ug |
$450.00
|
|
RC210567L3 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC210567L4 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), mGFP tagged | 10 ug |
$450.00
|
|
RG210567 | DNAJC15 (tGFP-tagged) - Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15) | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.