DNAJC15 (NM_013238) Human Untagged Clone

SKU
SC115339
DNAJC15 (untagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DNAJC15
Synonyms DNAJD1; HSD18; MCJ
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC115339 sequence for NM_013238 edited (data generated by NextGen Sequencing)
ATGGCTGCCCGTGGTGTCATCGCTCCAGTTGGCGAGAGTTTGCGCTACGCTGAGTACTTG
CAGCCCTCGGCCAAACGGCCAGACGCCGACGTCGACCAGCAGAGACTGGTAAGAAGTTTG
ATAGCTGTAGGCCTGGGTGTTGCAGCTCTTGCATTTGCAGGTCGCTACGCATTTCGGATC
TGGAAACCTCTAGAACAAGTTATCACAGAAACTGCAAAGAAGATTTCAACTCCTAGCTTT
TCATCCTACTATAAAGGAGGATTTGAACAGAAAATGAGTAGGCGAGAAGCTGGTCTTATT
TTAGGTGTAAGCCCATCTGCTGGCAAGGCTAAGATTAGAACAGCTCATAGGAGAGTCATG
ATTTTGAATCACCCAGATAAAGGTGGATCTCCTTACGTAGCAGCCAAAATAAATGAAGCA
AAAGACTTGCTAGAAACAACCACCAAACATTGA

Clone variation with respect to NM_013238.2
132 a=>c
Restriction Sites Please inquire
ACCN NM_013238
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013238.2, NP_037370.2
RefSeq Size 2792 bp
RefSeq ORF 453 bp
Locus ID 29103
UniProt ID Q9Y5T4
Cytogenetics 13q14.11
Domains DnaJ
Protein Families Transmembrane
Summary Negative regulator of the mitochondrial respiratory chain. Prevents mitochondrial hyperpolarization state and restricts mitochondrial generation of ATP (By similarity). Acts as an import component of the TIM23 translocase complex. Stimulates the ATPase activity of HSPA9.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:DNAJC15 (NM_013238) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210567 DNAJC15 (Myc-DDK-tagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15) 10 ug
$150.00
RC210567L1 Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), Myc-DDK-tagged 10 ug
$450.00
RC210567L2 Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), mGFP tagged 10 ug
$450.00
RC210567L3 Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), Myc-DDK-tagged 10 ug
$450.00
RC210567L4 Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), mGFP tagged 10 ug
$450.00
RG210567 DNAJC15 (tGFP-tagged) - Human DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.