MTLRP (GHRL) (NM_016362) Human Untagged Clone

SKU
SC114299
GHRL (untagged)-Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MTLRP
Synonyms MTLRP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC114299 sequence for NM_016362 edited (data generated by NextGen Sequencing)
ATGCCCTCCCCAGGGACCGTCTGCAGCCTCCTGCTCCTCGGCATGCTCTGGCTGGACTTG
GCCATGGCAGGCTCCAGCTTCCTGAGCCCTGAACACCAGAGAGTCCAGCAGAGAAAGGAG
TCGAAGAAGCCACCAGCCAAGCTGCAGCCCCGAGCTCTAGCAGGCTGGCTCCGCCCGGAA
GATGGAGGTCAAGCAGAAGGGGCAGAGGATGAAATGGAAGTCCGGTTCAACGCCCCCTTT
GATGTTGGAATCAAGCTGTCAGGGGTTCAGTACCAGCAGCACAGCCAGGCCCTGGGGAAG
TTTCTTCAGGACATCCTCTGGGAAGAGGCCAAAGAGGCCCCAGCCGACAAGTGA

Clone variation with respect to NM_016362.3
214 c=>a
5' Read Nucleotide Sequence
>OriGene 5' read for NM_016362 unedited
CGGGNAGGNAACTGCAGGCCCACCTGTCTGCAACCCAGCTGAGGCCATGCCCTCCCCAGG
ACCGTCTGCAGCCTCCTGCTCCTCGGCATGCTCTGGCTGGACTTGGCCATGGCAGGCTCC
AGCTTCCTGAGCCCTGAACACCAGAGAGTCCAGCAGAGAAAGGAGTCGAAGAAGCCACCA
GCCAAGCTGCAGCCCCGAGCTCTAGCAGGCTGGCTCCGCCCGGAAGATGGAGGTCAAGCA
GAAGGGGCAGAGGATGAAATGGAAGTCCGGTTCAACGCCCCCTTTGATGTTGGAATCAAG
CTGTCAGGGGTTCAGTACCAGCAGCACAGCCAGGCCCTGGGGAAGTTTCTTCAGGACATC
CTCTGGGAAGAGGCCAAAGAGGCCCCAGCCGACAAGTGATCGCCCACAAGCCTTACTCAC
CTCTCTCTAAGTTTAGAAGCGCTCATCTGGCTTTTCGCTTGCTTCTGCAGCAACTCCCAC
GACTGTTGTACAAGCTCAGGAGGCGAATAAATGTTCAAACTGTAAAAAAAAAAAAAAAAA
AAAAAAAAGGGCGGNCCGCGGTCAATAGCTGTTTCCTGAACAGATCCCCGGGTGGCATCC
CCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGNAAGTTGCCACTCCAGTGCCCACC
AGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAAGTGTCCTTCTATAA
Restriction Sites Please inquire
ACCN NM_016362
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016362.2, NP_057446.1
RefSeq Size 518 bp
RefSeq ORF 354 bp
Locus ID 51738
UniProt ID Q9UBU3
Cytogenetics 3p25.3
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Summary This gene encodes the ghrelin-obestatin preproprotein that is cleaved to yield two peptides, ghrelin and obestatin. Ghrelin is a powerful appetite stimulant and plays an important role in energy homeostasis. Its secretion is initiated when the stomach is empty, whereupon it binds to the growth hormone secretagogue receptor in the hypothalamus which results in the secretion of growth hormone (somatotropin). Ghrelin is thought to regulate multiple activities, including hunger, reward perception via the mesolimbic pathway, gastric acid secretion, gastrointestinal motility, and pancreatic glucose-stimulated insulin secretion. It was initially proposed that obestatin plays an opposing role to ghrelin by promoting satiety and thus decreasing food intake, but this action is still debated. Recent reports suggest multiple metabolic roles for obestatin, including regulating adipocyte function and glucose metabolism. Alternative splicing results in multiple transcript variants. In addition, antisense transcripts for this gene have been identified and may potentially regulate ghrelin-obestatin preproprotein expression. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). This isoform (1) contains the ligands ghrelin-28 and obestatin. Variants 1, 8, 9, 11 and 12 encode the same protein.
Write Your Own Review
You're reviewing:MTLRP (GHRL) (NM_016362) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206989 GHRL (Myc-DDK-tagged)-Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 1 10 ug
$150.00
RC206989L1 Lenti ORF clone of Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC206989L2 Lenti ORF clone of Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 1, mGFP tagged 10 ug
$450.00
RC206989L3 Lenti ORF clone of Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC206989L4 Lenti ORF clone of Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 1, mGFP tagged 10 ug
$450.00
RG206989 GHRL (tGFP-tagged) - Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.