COX16 (NM_016468) Human Untagged Clone

SKU
SC114236
COX16 (untagged)-Human COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX16), nuclear gene encoding mitochondrial protein, transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol COX16
Synonyms C14orf112; hCOX16; HSPC203
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC114236 sequence for NM_016468 edited (data generated by NextGen Sequencing)
ATGTTTGCACCCGCGGTGATGCGTGCTTTTCGCAAGAACAAGACTCTCGGCTATGGAGTC
CCCATGTTGTTGCTGATTGTTGGAGGTTCTTTTGGTCTTCGTGAGTTTTCTCAAATCCGA
TATGATGCTGTGAAGAGTAAAATGGATCCTGAGCTTGAAAAAAAACTGAAAGAGAATAAA
ATATCTTTAGAGTCGGAATATGAGAAAATCAAAGACTCCAAGTTTGATGACTGGAAGAAT
ATTCGAGGACCCAGGCCTTGGGAAGATCCTGACCTCCTCCAAGGAAGAAATCCAGAAAGC
CTTAAGACTAAGACAACTTGA

Clone variation with respect to NM_016468.6
5' Read Nucleotide Sequence
>OriGene 5' read for NM_016468 unedited
TAGAATTTGTATACGACTCACTATAGGGCGGCCGCGATTCGGCACGAGGCTGAGATTTGG
GAGTCTGCGCTAGGCCCGCTTGGAGTTCTGAGCCGATGGAAGAGTTCACTTCATGTTTGC
ACCCGCGGTGATGCGTGCTTTTCGCAAGAACAAGACTCTCGGCTATGGAGTCCCCATGTT
GTTGCTGATTGTTGGAGGTTCTTTTGGTCTTCGTGAGTTTTCTCAAATCCGATATGATGC
TGTGAAGAGTAAAATGGATCCTGAGCTTGAAAAAAAACTGAAAGAGAATAAAATATCTTT
AGAGTCGGAATATGAGAAAATCAAAGACTCCAAGTTTGATGACTGGAAGAATATTCGAGG
ACCCAGGCNCTTGGGAAGATCCTGACCTCCTCCAAGGAAGAAATCCAGAAAGCCTTAAGA
CTAAGACAACTTGACTCTGCTGATTCTTTTTTCCTTTTTTTTTTTTTTAAATAAAAATAT
TATTAACTGGACTTCCTAATATATACTTCTATCAAGTGGAAAGGAAATTCCAGGCCCATG
GAAACTTGGATATGGGTAATTTTGATGACAAATAATCTTCACTAAAGGTCATGTACAGGG
TTTTTATACTTTCCCAGCTATTCCATCTGTGGGATGAAAGTAACAATGTTGGGCAAGTTA
TATTTTACACCCTCGAAATAAAAAATGGTGAAACCTGCTCCAAAAACAAAGTCACGTATT
TCCACTTTCCAACTACCCACATTTTCCTTTTTGCATACCCCTTTAGGGCATCATTTGGAA
ATTCATTTCGGGATTTCTGATCTTTGAATTCGGAATCCCAAGGAGGCACATAGGGTTTGG
GAACCCAATTTTCCAGGAAAATAAAGCCGNAATTTTTTTCTCATTTATAAT
Restriction Sites NotI-NotI
ACCN NM_016468
Insert Size 1640 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016468.3, NP_057552.1
RefSeq Size 710 bp
RefSeq ORF 321 bp
Locus ID 51241
UniProt ID Q9P0S2
Cytogenetics 14q24.2
Protein Families Secreted Protein, Transmembrane
Summary Required for the assembly of the mitochondrial respiratory chain complex IV (CIV), also known as cytochrome c oxidase (PubMed:29355485, PubMed:29381136). Promotes the insertion of copper into the active site of cytochrome c oxidase subunit II (MT-CO2/COX2) (PubMed:29355485, PubMed:29381136). Interacts specifically with newly synthesized MT-CO2/COX and its copper center-forming metallochaperones SCO1, SCO2 and COA6 (PubMed:29381136). Probably facilitates MT-CO2/COX2 association with the MITRAC assembly intermediate containing MT-CO1/COX1, thereby participating in merging the MT-CO1/COX1 and MT-CO2/COX2 assembly lines (PubMed:29381136).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:COX16 (NM_016468) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200099 COX16 (Myc-DDK-tagged)-Human COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX16), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$150.00
RC200099L3 Lenti ORF clone of Human COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX16), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC200099L4 Lenti ORF clone of Human COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX16), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$450.00
RG200099 COX16 (tGFP-tagged) - Human COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX16), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.