AICDA (NM_020661) Human Untagged Clone

CAT#: SC113038

AICDA (untagged)-Human activation-induced cytidine deaminase (AICDA)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name AICDA (NM_020661) Human Untagged Clone
Symbol AICDA
Synonyms AID; ARP2; CDA2; HEL-S-284; HIGM2
Vector pCMV6-XL4
Sequence Data
>OriGene ORF within SC113038 sequence for NM_020661 edited (data generated by NextGen Sequencing)
ATGGACAGCCTCTTGATGAACCGGAGGAAGTTTCTTTACCAATTCAAAAATGTCCGCTGG
GCTAAGGGTCGGCGTGAGACCTACCTGTGCTACGTAGTGAAGAGGCGTGACAGTGCTACA
TCCTTTTCACTGGACTTTGGTTATCTTCGCAATAAGAACGGCTGCCACGTGGAATTGCTC
TTCCTCCGCTACATCTCGGACTGGGACCTAGACCCTGGCCGCTGCTACCGCGTCACCTGG
TTCACCTCCTGGAGCCCCTGCTACGACTGTGCCCGACATGTGGCCGACTTTCTGCGAGGG
AACCCCAACCTCAGTCTGAGGATCTTCACCGCGCGCCTCTACTTCTGTGAGGACCGCAAG
GCTGAGCCCGAGGGGCTGCGGCGGCTGCACCGCGCCGGGGTGCAAATAGCCATCATGACC
TTCAAAGATTATTTTTACTGCTGGAATACTTTTGTAGAAAACCATGAAAGAACTTTCAAA
GCCTGGGAAGGGCTGCATGAAAATTCAGTTCGTCTCTCCAGACAGCTTCGGCGCATCCTT
TTGCCCCTGTATGAGGTTGATGACTTACGAGACGCATTTCGTACTTTGGGACTTTGA

Clone variation with respect to NM_020661.2
465 c=>t
>OriGene 5' read for NM_020661 unedited
ACGACTCACTATATGGCGGCCGCGAATTCGGCACGAGGGAACCATCATTAATTGAAGTGA
GATTTTTCTGGCCTGAGACTTGCAGGGAGGCAAGAAGACACTCTGGACACCACTATGGAC
AGCCTCTTGATGAACCGGAGGAAGTTTCTTTACCAATTCAAAAATGTCCGCTGGGCTAAG
GGTCGGCGTGAGACCTACCTGTGCTACGTAGTGAAGAGGCGTGACAGTGCTACATCCTTT
TCACTGGACTTTGGTTATCTTCGCAATAAGAACGGCTGCCACGTGGAATTGCTCTTCCTC
CGCTACATCTCGGACTGGGACCTAGACCCTGGCCGCTGCTACCGCGTCACCTGGTTCACC
TCCTGGAGCCCCTGCTACGACTGTGCCCGACATGTGGCCGACTTTCTGCGAGGGAACCCC
AACCTCAGTCTGAGGATCTTCACCGCGCGCCTCTACTTCTGTGAGGACCGCAAGGCTGAG
CCCGAGGGGCTGCGGCGGCTGCACCGCGCCGGGGTGCAAATAGCCATCATGACCTTCAAA
GATTATTTTTACTGCTGGAATACTTTTGTAGAAAACCATGAAAGAACTTTCAAAGCCTGG
GAAGGGCTGCATGAAAATTCAGTTCGTCTCTCCAGACAGCTTCNGCGCATCCTTTTGCCC
CTGTATGAGGTTGATGACTTACGAGACGCATTTCGTACTTTGGGACTTTGATAGCAACTT
CCAGGAATGTCACACACGATGAAATTN
Tag Tag Free
ACCN NM_020661
ORF Size 597 bp
Insert Size 1500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_020661.1, NP_065712
RefSeq Size 2791
RefSeq ORF 597
Locus ID 57379
Cytogenetics 12p13.31
Protein Families Druggable Genome
Protein Pathways Primary immunodeficiency
Gene Summary This gene encodes a RNA-editing deaminase that is a member of the cytidine deaminase family. The protein is involved in somatic hypermutation, gene conversion, and class-switch recombination of immunoglobulin genes. Defects in this gene are the cause of autosomal recessive hyper-IgM immunodeficiency syndrome type 2 (HIGM2). [provided by RefSeq, Feb 2009].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.