FGF12 (NM_021032) Human Untagged Clone

CAT#: SC113009

FGF12 (untagged)-Human fibroblast growth factor 12 (FGF12), transcript variant 1

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FGF12 (NM_021032) Human Untagged Clone
Symbol FGF12
Synonyms FGF12B; FHF1
Vector pCMV6-XL5
Sequence Data
>NCBI ORF sequence for NM_021032, the custom clone sequence may differ by one or more nucleotides


ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAGTCCAACAGCGACCGAG
TGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGACGGGCGCTCCCTGTGCGAGAGGCACGTCCTCGG
GGTGTTCAGCAAAGTGCGCTTCTGCAGCGGCCGCAAGAGGCCGGTGAGGCGGAGACCAGAACCCCAGCTC
AAAGGGATTGTGACAAGGTTATTCAGCCAGCAGGGATACTTCCTGCAGATGCACCCAGATGGTACCATTG
ATGGGACCAAGGACGAAAACAGCGACTACACTCTCTTCAATCTAATTCCCGTGGGCCTGCGTGTAGTGGC
CATCCAAGGAGTGAAGGCTAGCCTCTATGTGGCCATGAATGGTGAAGGCTATCTCTACAGTTCAGATGTT
TTCACTCCAGAATGCAAATTCAAGGAATCTGTGTTTGAAAACTACTATGTGATCTATTCTTCCACACTGT
ACCGCCAGCAAGAATCAGGCCGAGCTTGGTTTCTGGGACTCAATAAAGAAGGTCAAATTATGAAGGGGAA
CAGAGTGAAGAAAACCAAGCCCTCATCACATTTTGTACCGAAACCTATTGAAGTGTGTATGTACAGAGAA
CCATCGCTACATGAAATTGGAGAAAAACAAGGGCGTTCAAGGAAAAGTTCTGGAACACCAACCATGAATG
GAGGCAAAGTTGTGAATCAAGATTCAACATAG


>OriGene 5' read for NM_021032 unedited
NGTTCAAATTTTGGTATACGAACTCACTATAGGGCGGCCGCGAATTCGCACGAGGCTGGA
TTTTCCACATTTTGTCGCCACTGCCCAGACTTTGACTAACCTTGTGAGCGCCGGGTTTTC
GATACTGCAGCCTCCTCAAATTTTAGCACTGCCTCCCCGCGACTGCCCTTTCCCTGGCCG
CCCAGGTCCTGCCCTCGCCCCGGCGGAGCGCAAGCCGGAGGGCGCAGTAGAGGCTGGGGC
CTGAGGCCCTCGCTGAGCAGCTATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAA
GCGGCAGGCGAGGGAGTCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCC
CAGCAAAGACGGGCGCTCCCTGTGCGAGAGGCACGTCCTCGGGGTGTTCAGCAAAGTGCG
CTTCTGCAGCGGCCGCAAGAGGCCGGTGAGGCGGAGACCAGAACCCCAGCTCAAAGGGAT
TGTGACAAGGTTATTCAGCCAGCAGGGATACTTCCTGCAGATGCACCCAGATGGTACCAT
TGATGGGACCAAGGACGAAAACAGCGACTACACTCTCTTCAATCTAATTCCCGTGGGCCT
GCGTGTAGTGGCCATCCAAGGAGTGAAGGCTAGCCTCTATGTGGCCATGAATGGTGAAGG
CTATCTCTACAGTTCAGATGTTTTCACTCCAGAATGCAAATTCAAGGAATCTGTGTTTGA
AAACTACTATGTGATCTATTCTTCCACACTGTACCGCCAGCAAGAATCAGGCCGAGCTTG
GTTTCTGGGACTCAATAAAGAAGGTCANATTATGAAGGGGAACAGAGTGAAGAANACCCA
AGCCTCATCACATTNTGTACCGAAACCTATTGAAGTGTGTATGTACAGAGAACCATCGCT
ACATGAAATGGNAGAANAACAAGG
>OriGene 3' read for NM_021032 unedited
ACCGCGGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTAAAAAATTT
AAATGTCTTTATTTGTTACTTTCCAAATATTTTGGTTAAACAAATATCTCTTGCAAATGT
ATCTTCAAAATCTTTGCCTACATGCATACAATTTGTTCTTCCCAACTGCTTAGGGAAATT
CCTTCATTTCATTTTCTGCTAACCTCTAGATAACAGAAATAGGATACCTGGTGAAGGATA
TGGTCCACTATTGAAGAATAATGATTGTGTAAAGTGAGGGAAACTATATTGACCTTGAAA
TACGGCAACCAATGGCAAGGTTTGAGGTGAGGGCCTAAAGCTTCTGCAAAGTGTATATAT
TTTAGGGAGTCATATTTGGAACAATACATGCTGGACAGTAGAGATATAGGAGAAGTTACA
TGCTATGTCTTCTCATTGATAATATCCATAAATCTGCATACATTTTTAACATTCTGTTTT
GTGTTTTTTTTTCTTTAAATTTGGATGTCTCTACACCACTCCTGATTTGTAGGACTAAAT
AGATCTATTTATTCCAATGCAAATTGTGTAACATTTATTTCTTCCTTGATTTTTAAAAAT
ACTTTAGTATTCTTAACTATGTATGTGCCTTCTCTTACACTGAGTTCTTTTTTGCTCCTT
TCAGCTGCTCACACAATCCTGTCTGTTGGAGTCATAGACTGCTATTCCATATTATTTCTC
TACACACCCTTGACATTTAGTGTATTACTGGTACCCTTCTGTGTTCTTAGAAACAATGAA
TTGCAACTGGACTTGTACAGGATCCTACTAGAGCCACAATTACTCTGGCTTGTAAGAAAG
TAAGTAGAATTTACAGTCATGCTCCAATTCATGCCAGAGTTAAAAACAATTAGACTGTGG
TAAGTCAAAGCAATGCATTTGCGTGACTAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_021032
ORF Size 732 bp
Insert Size 2900
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021032.2, NP_066360
RefSeq Size 2817
RefSeq ORF 732
Locus ID 2257
Cytogenetics 3q28-q29
Domains FGF
Protein Families Secreted Protein
Protein Pathways MAPK signaling pathway, Regulation of actin cytoskeleton, Pathways in cancer, Melanoma
Gene Summary The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This growth factor lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, this protein accumulated in the nucleus, but was not secreted. The specific function of this gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes a longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.