ILRUN (NM_024294) Human Untagged Clone

CAT#: SC112260

Reviews ()
Write a review

C6orf106 (untagged)-Human chromosome 6 open reading frame 106 (C6orf106), transcript variant 1



  "NM_024294" in other vectors (5)

Reconstitution Protocol

USD 726.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ILRUN
Synonyms C6orf106; dJ391O22.4; FP852
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_024294, the custom clone sequence may differ by one or more nucleotides


ATGGAGGGCATGGACGTAGACCTGGACCCGGAGCTGATGCAGAAGTTCAGCTGCCTGGGCACCACCGACA
AGGACGTGCTCATCTCCGAGTTCCAGAGGCTGCTCGGCTTCCAGCTCAATCCTGCCGGTTGCGCCTTCTT
CCTGGACATGACCAACTGGAACCTACAAGCAGCAATTGGCGCCTATTATGACTTTGAGAGCCCAAACATC
AGTGTGCCCTCTATGTCCTTTGTTGAAGATGTCACCATAGGAGAAGGGGAGTCAATACCTCCGGATACTC
AGTTTGTAAAAACATGGCGGATCCAGAATTCTGGGGCAGAGGCCTGGCCTCCAGGGGTTTGTCTTAAATA
TGTCGGGGGAGACCAATTTGGACATGTGAACATGGTGATGGTGAGATCGCTAGAGCCCCAAGAGATTGCA
GATGTCAGCGTCCAGATGTGCAGCCCCAGCAGAGCAGGAATGTATCAGGGACAGTGGCGGATGTGCACTG
CTACAGGACTCTACTATGGAGATGTCATCTGGGTGATTCTCAGTGTGGAGGTGGGTGGACTTTTAGGAGT
AACGCAGCAGCTGTCATCTTTTGAAACGGAGTTCAACACACAGCCGCATCGTAAGGTAGAAGGAAACTTC
AACCCTTTTGCCTCTCCCCAAAAGAACCGACAATCAGATGAAAACAACTTAAAAGACCCTGGGGGCTCCG
AGTTCGACTCGATCAGCAAAAACACATGGGCTCCTGCTCCTGACACATGGGCTCCTGCTCCTGACCAAAC
TGAGCAAGACCAGAATAGACTGTCACAGAACTCTGTAAATCTGTCTCCCAGCAGTCACGCAAACAACTTA
TCAGTAGTGACTTACAGTAAGGGGCTCCATGGGCCTTACCCCTTCGGCCAGTCTTAA


>OriGene 5' read for NM_024294 unedited
GGTTCACTATTTTGTAACACGACTCACTATAGGGCGGCCGCGCAATTCGCACGAGGCGGC
GGCGCGGCGGCGGCTTGGTTGTGAAGAGGCGGGGAAGCGGGTGTCCGGTCCCCGCCATGG
AGGGCATGGACGTAGACCTGGACCCGGAGCTGATGCAGAAGTTCAGCTGCCTGGGCACCA
CCGACAAGGACGTGCTCATCTCCGAGTTCCAGAGGCTGCTCGGCTTCCAGCTCAATCCTG
CCGGTTGCGCCTTCTTCCTGGACATGACCAACTGGAACCTACAAGCAGCAATTGGCGCCT
ATTATGACTTTGAGAGCCCAAACATCAGTGTGCCCTCTATGTCCTTTGTTGAAGATGTCA
CCATAGGAGAAGGGGAGTCAATACCTCCGGATACTCAGTTTGTAAAAACATGGCGGATCC
AGAATTCTGATGTCATCTGGGTGATTCTCAGTGTGGAGGCGGGTGGACTTTTACGAGTAA
CGCAGCAGCTGTCCATCTTTTGAAACGGAGTTCAACACACAGCCGCATCGCAAGGTAGAA
GGAAACTTCAACCCTTTTGCCTCTCCTCAAAAGAACCGACAATCAGATGAAAACAACTCA
TAAGACCCTGCGGGCTTCGAGNTCCAATCGATCAGCAAAAAAACATTGGGCTCCTGCCTC
CTGACACATGGGCTTCCTGCTTCTTGACCAAACTGAGCAAGACCAGAATACACTGTCCCA
GAACCCTGCAATCCGTCTCCCATTACTCCTGTCCACCCCTTATCGCATCGCCTTACAGGA
ACGGGCTCCATGGGCCTACCCCTTCCGCCACCCTTACCCGGTGGTCACCCGAACAAAATT
AACAACGACAGAGGGCCGACTTTGGGGGGTTGGGCAGGGGTTTTCTGGAATGCCCACCAC
TCGCACAATCCCGGT
>OriGene 3' read for NM_024294 unedited
GGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTGGAAGAAAACAATTT
TAATTGTTACAAGGGTGTGCAGAAGGACACCTCTCAGGCTTAAAAAATCCCACGTCACCC
GAGATCTATCCTCAAGGCTTCCTCTGCTGGCCACACAGGGAAGTTTGGTCTTCAGAGAGG
TTCTGATGCTAACAAGCCACAGGGTTGACGAATACAAATGTCAAAGGTGTAAATCAACAG
AAGATTAAAGAGAAAAGAGGAGGAAAAGGGTGATAACTCATTGGCTGATGCCATTAAAAA
CAAATGGGGTCAGAGACTTCTGGAGTCATGTGGCAGGGCAGATGTACTCCTGTAGCACTG
ATCCGCAGAGTCCTCAAACATGCCACGCCAACTTTTCACCTGAATCTCTTCCAGAACAAG
CACTATTCTATAAAGAATATGTTATCCCTTATTTAAAAAAATAAAAGTGGGGAAAGAGGG
AAAAAAATTAACATGTGCTCAAAACTACAACCTTTCTGTAGGCAAAATAATTTTTGTTTA
AAAAGATGGCTTTTTTTCCCCCATTTTAAACTTTTTCCCCCTTCCCGAGTAACCTAATGA
CTTGTTAGACTGATGCCTATAACAAAACCCAAAGTGGCTACATGGATTTCTTCTTGGTAG
CCTCAACACCATTCCTGTGATTCAGCATTCACACATGCATACTGAGTTNACTCAAAACTA
GNCTGTTCTGCTTCTTCCTCTTCTTCCCGGATGAGAGGGGGTCAGAGCCCAGGGTCTGTG
CGATGTGGTCTGCATCCANAGAACCCCTTGCCCTACCCCCAAGTCAGCCCTCTGCCTTTT
TGTATTTNTCTCCTGCTGACCCCGTTTAAAACTGGCCGANGGGTAGGCCCATGNACCCCT
ACTGTAGTCACTCTGTAAANTTGTTGCTGACTGTGGAAGAAGATTACGAGTCTGTGAATC
TTTCTGG
Restriction Sites NotI-NotI     
ACCN NM_024294
Insert Size 1680 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_024294.2, NP_077270.1
RefSeq Size 4430 bp
RefSeq ORF 897 bp
Locus ID 64771
UniProt ID Q9H6K1
Cytogenetics 6p21.31
Gene Summary Negative regulator of innate antiviral response. Blocks IRF3-dependent cytokine production such as IFNA, IFNB and TNF (PubMed:29802199). Interacts with IRF3 and inhibits IRF3 recruitment to type I IFN promoter sequences while also reducing nuclear levels of the coactivators EP300 and CREBBP (PubMed:29802199).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).

Other Versions

Other products for "ILRUN"
Frequently bought together (4)
Rabbit Polyclonal Anti-C6orf106 Antibody
    • 100 ul

USD 475.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.