LRRC2 (NM_024750) Human Untagged Clone

SKU
SC112036
LRRC2 (untagged)-Human leucine rich repeat containing 2 (LRRC2), transcript variant 2
$457.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LRRC2
Synonyms leucine-rich repeat-containing 2; leucine rich repeat containing 2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_024750, the custom clone sequence may differ by one or more nucleotides


ATGGGACATAAAGTGGTTGTCTTCGACATTTCTGTCATCAGAGCCTTGTGGGAAACTCGTGTCAAGAAGC
ACAAAGCTTGGCAGAAGAAGGAGGTGGAAAGGCTTGAGAAGAGCGCCTTGGAGAAGATAAAGGAGGAGTG
GAACTTTGTGGCCGAATGCAGGAGGAAGGGCATCCCCCAGGCTGTATACTGCAAGAATGGCTTCATAGAC
ACCAGCGTGCGGCTTCTGGACAAGATTGAAAGGAACACTCTCACAAGGCAGAGTTCACTTCCCAAGGACA
GAGGCAAACGGAGCAGTGCGTTTGTGTTTGAACTTTCTGGGGAGCACTGGACGGAGCTCCCAGATTCATT
GAAGGAGCAGACACACCTGAGAGAATGGTACATAAGCAATACCTTGATTCAAATCATTCCTACATATATT
CAGTTATTTCAAGCGATGAGAATTCTGGATCTGCCAAAAAACCAAATCTCACATCTTCCAGCAGAAATCG
GTTGTTTGAAGAACCTGAAAGAACTCAATGTGGGTTTCAACTATCTGAAGAGCATTCCTCCAGAATTGGG
AGATTGTGAAAATCTAGAGAGACTGGATTGTTCTGGAAATCTAGAATTAATGGAGCTGCCCTTTGAATTA
AGTAATTTGAAGCAAGTTACATTTGTAGATATCTCAGCAAACAAGTTTTCCAGTGTCCCAATCTGTGTCC
TGCGGATGTCGAATTTGCAGTGGTTGGATATCAGCAGCAATAACCTGACCGACCTGCCGCAAGATATAGA
CAGGCTAGAGGAGCTGCAGAGCTTTCTCTTGTATAAAAACAAGTTGACCTACCTTCCCTATTCCATGCTG
AACCTGAAGAAGCTCACTCTGTTAGTCGTCAGTGGGGACCATTTGGTGGAGCTCCCAACTGCCCTTTGTG
ACTCATCCACACCTTTAAAATTTGTAAGCCTTATGGACAATCCTATTGATAATGCCCAATGTGAAGATGG
CAATGAAATAATGGAAAGTGAACGGGATCGCCAACATTTTGATAAAGAAGTTATGAAAGCCTATATTGAA
GACCTTAAAGAAAGAGAATCTGTTCCCAGCTATACCACCAAAGTGTCTTTTAGCCTTCAACTTTGA


Restriction Sites NotI-NotI
ACCN NM_024750
Insert Size 4700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024750.2, NP_079026.2
RefSeq Size 1946 bp
RefSeq ORF 1116 bp
Locus ID 79442
Cytogenetics 3p21.31
Domains LRR, LRR_PS, LRR_TYP
Protein Families Druggable Genome
Summary This gene encodes a member of the leucine-rich repeat-containing family of proteins, which function in diverse biological pathways. This family member may possibly be a nuclear protein. Similarity to the RAS suppressor protein, as well as expression down-regulation observed in tumor cells, suggests that it may function as a tumor suppressor. The gene is located in the chromosome 3 common eliminated region 1 (C3CER1), a 1.4 Mb region that is commonly deleted in diverse tumors. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.
Write Your Own Review
You're reviewing:LRRC2 (NM_024750) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206380 LRRC2 (Myc-DDK-tagged)-Human leucine rich repeat containing 2 (LRRC2), transcript variant 2 10 ug
$457.00
RC206380L1 Lenti ORF clone of Human leucine rich repeat containing 2 (LRRC2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC206380L2 Lenti ORF clone of Human leucine rich repeat containing 2 (LRRC2), transcript variant 2, mGFP tagged 10 ug
$757.00
RC206380L3 Lenti ORF clone of Human leucine rich repeat containing 2 (LRRC2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC206380L4 Lenti ORF clone of Human leucine rich repeat containing 2 (LRRC2), transcript variant 2, mGFP tagged 10 ug
$757.00
RG206380 LRRC2 (tGFP-tagged) - Human leucine rich repeat containing 2 (LRRC2), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC324677 LRRC2 (untagged)-Human leucine rich repeat containing 2 (LRRC2), transcript variant 2 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.