LRRC2 (NM_024750) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | LRRC2 |
Synonyms | leucine-rich repeat-containing 2; leucine rich repeat containing 2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_024750, the custom clone sequence may differ by one or more nucleotides
ATGGGACATAAAGTGGTTGTCTTCGACATTTCTGTCATCAGAGCCTTGTGGGAAACTCGTGTCAAGAAGC ACAAAGCTTGGCAGAAGAAGGAGGTGGAAAGGCTTGAGAAGAGCGCCTTGGAGAAGATAAAGGAGGAGTG GAACTTTGTGGCCGAATGCAGGAGGAAGGGCATCCCCCAGGCTGTATACTGCAAGAATGGCTTCATAGAC ACCAGCGTGCGGCTTCTGGACAAGATTGAAAGGAACACTCTCACAAGGCAGAGTTCACTTCCCAAGGACA GAGGCAAACGGAGCAGTGCGTTTGTGTTTGAACTTTCTGGGGAGCACTGGACGGAGCTCCCAGATTCATT GAAGGAGCAGACACACCTGAGAGAATGGTACATAAGCAATACCTTGATTCAAATCATTCCTACATATATT CAGTTATTTCAAGCGATGAGAATTCTGGATCTGCCAAAAAACCAAATCTCACATCTTCCAGCAGAAATCG GTTGTTTGAAGAACCTGAAAGAACTCAATGTGGGTTTCAACTATCTGAAGAGCATTCCTCCAGAATTGGG AGATTGTGAAAATCTAGAGAGACTGGATTGTTCTGGAAATCTAGAATTAATGGAGCTGCCCTTTGAATTA AGTAATTTGAAGCAAGTTACATTTGTAGATATCTCAGCAAACAAGTTTTCCAGTGTCCCAATCTGTGTCC TGCGGATGTCGAATTTGCAGTGGTTGGATATCAGCAGCAATAACCTGACCGACCTGCCGCAAGATATAGA CAGGCTAGAGGAGCTGCAGAGCTTTCTCTTGTATAAAAACAAGTTGACCTACCTTCCCTATTCCATGCTG AACCTGAAGAAGCTCACTCTGTTAGTCGTCAGTGGGGACCATTTGGTGGAGCTCCCAACTGCCCTTTGTG ACTCATCCACACCTTTAAAATTTGTAAGCCTTATGGACAATCCTATTGATAATGCCCAATGTGAAGATGG CAATGAAATAATGGAAAGTGAACGGGATCGCCAACATTTTGATAAAGAAGTTATGAAAGCCTATATTGAA GACCTTAAAGAAAGAGAATCTGTTCCCAGCTATACCACCAAAGTGTCTTTTAGCCTTCAACTTTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_024750 |
Insert Size | 4700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_024750.2, NP_079026.2 |
RefSeq Size | 1946 bp |
RefSeq ORF | 1116 bp |
Locus ID | 79442 |
Cytogenetics | 3p21.31 |
Domains | LRR, LRR_PS, LRR_TYP |
Protein Families | Druggable Genome |
Summary | This gene encodes a member of the leucine-rich repeat-containing family of proteins, which function in diverse biological pathways. This family member may possibly be a nuclear protein. Similarity to the RAS suppressor protein, as well as expression down-regulation observed in tumor cells, suggests that it may function as a tumor suppressor. The gene is located in the chromosome 3 common eliminated region 1 (C3CER1), a 1.4 Mb region that is commonly deleted in diverse tumors. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC206380 | LRRC2 (Myc-DDK-tagged)-Human leucine rich repeat containing 2 (LRRC2), transcript variant 2 | 10 ug |
$457.00
|
|
RC206380L1 | Lenti ORF clone of Human leucine rich repeat containing 2 (LRRC2), transcript variant 2, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC206380L2 | Lenti ORF clone of Human leucine rich repeat containing 2 (LRRC2), transcript variant 2, mGFP tagged | 10 ug |
$757.00
|
|
RC206380L3 | Lenti ORF clone of Human leucine rich repeat containing 2 (LRRC2), transcript variant 2, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC206380L4 | Lenti ORF clone of Human leucine rich repeat containing 2 (LRRC2), transcript variant 2, mGFP tagged | 10 ug |
$757.00
|
|
RG206380 | LRRC2 (tGFP-tagged) - Human leucine rich repeat containing 2 (LRRC2), transcript variant 2 | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
SC324677 | LRRC2 (untagged)-Human leucine rich repeat containing 2 (LRRC2), transcript variant 2 | 10 ug |
$457.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.