Acid Phosphatase (ACP1) (NM_004300) Human Untagged Clone

SKU
SC111923
ACP1 (untagged)-Human acid phosphatase 1, soluble (ACP1), transcript variant 3
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Acid Phosphatase
Synonyms HAAP; LMW-PTP; LMWPTP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111923 sequence for NM_004300 edited (data generated by NextGen Sequencing)
ATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGGGTAACATTTGTCGATCA
CCCATTGCAGAAGCAGTTTTCAGGAAACTTGTAACCGATCAAAACATCTCAGAGAATTGG
AGGGTAGACAGCGCGGCAACTTCCGGGTATGAGATAGGGAACCCCCCTGACTACCGAGGG
CAGAGCTGCATGAAGAGGCACGGCATTCCCATGAGCCACGTTGCCCGGCAGATTACCAAA
GAAGATTTTGCCACATTTGATTATATACTATGTATGGATGAAAGCAATCTGAGAGATTTG
AATAGAAAAAGTAATCGAGTTAAAACCTGCAAAGCTAAAATTGAACTACTTGGGAGCTAT
GATCCACAAAAACAACTTATTATTGAAGATCCCTATTATGGGAATGACTCTGACTTTGAG
ACGGTGTACCAGCAGTGTGTCAGGTGCTGCAGAGCGTTCTTGGAGAAGGCCCACTGA

Clone variation with respect to NM_004300.3
317 a=>g
Restriction Sites NotI-NotI
ACCN NM_004300
Insert Size 1570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004300.2, NP_004291.1
RefSeq Size 1549 bp
RefSeq ORF 477 bp
Locus ID 52
UniProt ID P24666
Cytogenetics 2p25.3
Domains LMWPc
Protein Families Druggable Genome, Phosphatase, Transmembrane
Protein Pathways Adherens junction, Riboflavin metabolism
Summary The product of this gene belongs to the phosphotyrosine protein phosphatase family of proteins. It functions as an acid phosphatase and a protein tyrosine phosphatase by hydrolyzing protein tyrosine phosphate to protein tyrosine and orthophosphate. This enzyme also hydrolyzes orthophosphoric monoesters to alcohol and orthophosphate. This gene is genetically polymorphic, and three common alleles segregating at the corresponding locus give rise to six phenotypes. Each allele appears to encode at least two electrophoretically different isozymes, Bf and Bs, which are produced in allele-specific ratios. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (3) has multiple differences in the coding region, compared to variant 4. The resulting protein (isoform c, also known as Bf) has a distinct C-terminus and is longer than isoform d. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Write Your Own Review
You're reviewing:Acid Phosphatase (ACP1) (NM_004300) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212653 ACP1 (Myc-DDK-tagged)-Human acid phosphatase 1, soluble (ACP1), transcript variant 3 10 ug
$150.00
RC212653L1 Lenti ORF clone of Human acid phosphatase 1, soluble (ACP1), transcript variant 3, Myc-DDK-tagged 10 ug
$450.00
RC212653L2 Lenti ORF clone of Human acid phosphatase 1, soluble (ACP1), transcript variant 3, mGFP tagged 10 ug
$450.00
RC212653L3 Lenti ORF clone of Human acid phosphatase 1, soluble (ACP1), transcript variant 3, Myc-DDK-tagged 10 ug
$450.00
RC212653L4 Lenti ORF clone of Human acid phosphatase 1, soluble (ACP1), transcript variant 3, mGFP tagged 10 ug
$450.00
RG212653 ACP1 (tGFP-tagged) - Human acid phosphatase 1, soluble (ACP1), transcript variant 3 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.