RFXANK (NM_003721) Human Untagged Clone

CAT#: SC111713

RFXANK (untagged)-Human regulatory factor X-associated ankyrin-containing protein (RFXANK), transcript variant 1

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name RFXANK (NM_003721) Human Untagged Clone
Symbol RFXANK
Synonyms ANKRA1; BLS; F14150_1; RFX-B
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111713 sequence for NM_003721 edited (data generated by NextGen Sequencing)
ATGGAGCTTACCCAGCCTGCAGAAGACCTCATCCAGACCCAGCAGACCCCTGCCTCAGAA
CTTGGGGACCCTGAAGACCCCGGAGAGGAGGCTGCAGATGGCTCAGACACTGTGGTCCTC
AGTCTCTTTCCCTGCACCCCTGAGCCTGTGAATCCTGAACCGGATGCCAGTGTTTCCTCT
CCACAGNNNNGCAGCTCCCTGAAGCACTCCACCACTCTCACCAACCGGCAGCGAGGGAAC
GAGGTGTCAGCTCTGCCGGCCACCCTAGACTCCCTGTCCATCCACCAGCTCGCAGCACAG
GGGGAGCTGGACCAGCTGAAGGAGCATTTGCGGAAAGGTGACAACCTCGTCAACAAGCCA
GACGAGCGCGGCTTCACCCCCCTCATCTGGGCCTCCGCCTTTGGAGAGATTGAGACCGTT
CGCTTCCTGCTGGAGTGGGGTGCCGACCCCCACATCCTGGCAAAAGAGCGAGAGAGCGCC
CTGTCGCTGGCCAGCACAGGCGGCTACACAGACATTGTGGGGCTGCTGCTGGAGCGTGAC
GTGGACATCAACATCTATGATTGGAATGGAGGGACGCCACTGCTGTACGCTGTGCGCGGG
AACCACGTGAAATGCGTTGAGGCCTTGCTGGCCCGAGGCGCTGACCTCACCACCGAAGCC
GACTCTGGCTACACCCCGATGGACCTTGCCGTGGCCCTGGGATACCGGAAAGTGCAACAG
GTGATCGAGAACCACATCCTCAAGCTCTTCCAGAGCAACCTGGTGCCCGCTGACCCTGAG
TGA

Clone variation with respect to NM_003721.2
187 g=>n;188 c=>n;189 a=>n;190 g=>n
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003721 unedited
GATTTTGTATCCGACTACTATAGGCGGCCGCGAATTCGGCACGAGGCCGGTCTCCAGTTT
GCCTCCTGCTATATCCATTGGAAGAGAAAGTTTGTGACTTGGGCCCCCAAGTTTTGAGAG
AACTGGGCTTTCGGCGCGGGGGGACAGAGGAGGCTCGTGGGGAGCTTTCCCCATGGAGCT
TACCCAGCCTGCAGAAGACCTCATCCAGACCCAGCAGACCCCTGCCTCAGAACTTGGGGA
CCCTGAAGACCCCGGAGAGGAGGCTGCAGATGGCTCAGACACTGTGGTCCTCAGTCTCTT
TCCCTGCACCCCTGAGCCTGTGAATCCTGAACCGGATGCCAGTGTTTCCTCTCCACAGGG
CAGCTCCCTGAAGCACTCCACCACTCTCACCAACCGGCAGCGAGGGAACGAGGTGTCAGC
TCTGCCGGCCACCCTAGACTCCCTGTCCATCCACCAGCTCGCAGCACAGGGGGAGCTGGA
CCAGCTGAAGGAGCATTTGCGGAAAGGTGACAACCTCGTCAACAAGCCAGACGAGCGCGG
CTTCACCCCCCTCATCTGGGCCTCCGCCTTTGGAGAGATTGAGACCGATCGCTTCCTGCT
GGAGTGGGGTGCCCGACCCCCACATCCTGTCAAAAGAGCGAGAGAGCGCCCTGTCGCTGG
CCCGCACAGGCGGCCTCCACAAGACATTGTGGTGCTGCTGCCGGAGCGTGACGTGGACAT
CAACATCTATGACTGGAAATGGATGGACGCCACTGCTGGACGCTGTGCCGCGGGACCACG
TGAAATGCGTTGAGGCCTTGCTTGCCCCGAGCCGCTGACCTCACCCCCGAAAGCGCACTC
TGTCTACACCCCGATGAACCCTGCCGGGGCCCTGGGTATACCGGAAGGGCACCAGGGGAT
TGAGAACCCCATTCTCAGTTTTTTCCAAGCACCTGGGGCCCGGTGACCTCGATGAAGCCG
GCTGCCGGGCACTCAACC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003721 unedited
GGAAAAAAANTTACTTGNACCGCGCCGCAATCTANATCGAGTTTTTTTTTTTTTTTTTTC
TGCACAGAAGTTTATTGGTTCCTCTTGGGAAGGGTCCCCTCCCACCACCTGTCCAGAAGC
TGCCTTTGAAGTCAGTTCTGGGTTTCCCCAGCTCTGGCTGACCATTTTGTTCCCTGAGTG
TCTGAGTCCCCGGCAGGCGGCCTTCACTCAGGGTCAGCGGGCACCAGGTTGCTCTGGAAG
AGCTTGAGGATGTGGTTCTCGATCACCTGTTGCACTTTCCGGTATCCCAGGGCCCACGGC
AAGGTCCATNCGGGNTGTANCCAGAAGTCGCTTCGGTGGTGAGGTCAGCGCCTCGGGCCA
GCAGGCCTCAACGCATTTTACGTGGTTCCCGCGCCAGCGTACAGCAGTGGCGTCCCTCCA
TTCCATCATAGAATGTGATGTCCACGTNACGCTCCAACAGCAGCCCCACAATGTCTGTGG
TACCGCCTGTGCTGGCACACCACAGGCCGCTTTTTTGCTTCTTTTGCCAGATGTGGGGGT
CGCACCCCACTCCACCAGGAAACGAACCGGTCTAATTTCTTCCAAAGCCGAGGGCCAAAT
GAGGGGGGGTGAAACCGCCCTCCTTTGGCTTGGTTGACCAAGTTTACCCCTTTTCCCAAA
GGCCTCTTAACTGGGGCCAATTCCCCTTTTGCTTGAAACTTGGGGAAGGACCGGGATTTT
AGGGGGGCCGGAAAAAATTAAACCTCTTTTCCCTTCCTTCCCGGTTGGGAAAAATGGGGG
AATGCTTTAGGGAACCTCCCCTTGGGAAAAGGAAAACCCGGGTTCTCGGTTAAGAATTCC
AAGCCCCAGGGGGGGCGGGAAAAAAACCGAGGCCCACCTGGGTGGAACCTTTTGAAGCCC
CTTTTCCGGGGTTTTAGGGGCCCCCAATTTAGAGCAGGGGTTCTTGGGTTTAAAAAAATC
TTTTCGACGGGGGGGACCTCCGGGAAAAAATCCCAAAATCCTTTTGTTCCCCCGCCAGAA
CCATTA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003721
ORF Size 783 bp
Insert Size 1120
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003721.2, NP_003712
RefSeq Size 1438
Locus ID 8625
Cytogenetics 19p13.11
Domains ank
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Antigen processing and presentation, Primary immunodeficiency
Gene Summary Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (1) encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.