METTL3 (NM_019852) Human Untagged Clone

CAT#: SC111357

METTL3 (untagged)-Human methyltransferase like 3 (METTL3)

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name METTL3 (NM_019852) Human Untagged Clone
Symbol METTL3
Synonyms IME4; M6A; MT-A70; Spo8
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_019852, the custom clone sequence may differ by one or more nucleotides


ATGTCGGACACGTGGAGCTCTATCCAGGCCCACAAGAAGCAGCTGGACTCTCTGCGGGAGAGGCTGCAGC
GGAGGCGGAAGCAGGACTCGGGGCACTTGGATCTACGGAATCCAGAGGCAGCATTGTCTCCAACCTTCCG
TAGTGACAGCCCAGTGCCTACTGCACCCACCTCTGGTGGCCCTAAGCCCAGCACAGCTTCAGCAGTTCCT
GAATTAGCTACAGATCCTGAGTTAGAGAAGAAGTTGCTACACCACCTCTCTGATCTGGCCTTAACATTGC
CCACTGATGCTGTGTCCATCTGTCTTGCCATCTCCACGCCAGATGCTCCTGCCACTCAAGATGGGGTAGA
AAGCCTCCTGCAGAAGTTTGCAGCTCAGGAGTTGATTGAGGTAAAGCGAGGTCTCCTACAAGATGATGCA
CATCCTACTCTTGTAACCTATGCTGACCATTCCAAGCTCTCTGCCATGATGGGTGCTGTGGCAGAAAAGA
AGGGCCCTGGGGAGGTAGCAGGGACTGTCACAGGGCAGAAGCGGCGTGCAGAACAGGACTCGACTACAGT
AGCTGCCTTTGCCAGTTCGTTAGTCTCTGGTCTGAACTCTTCAGCATCGGAACCAGCAAAGGAGCCAGCC
AAGAAATCAAGGAAACATGCTGCCTCAGATGTTGATCTGGAGATAGAGAGCCTTCTGAACCAACAGTCCA
CTAAGGAACAACAGAGCAAGAAGGTCAGTCAGGAGATCCTAGAGCTATTAAATACTACAACAGCCAAGGA
ACAATCCATTGTTGAAAAATTTCGCTCTCGAGGTCGGGCCCAAGTGCAAGAATTCTGTGACTATGGAACC
AAGGAGGAGTGCATGAAAGCCAGTGATGCTGATCGACCCTGTCGCAAGCTGCACTTCAGACGAATTATCA
ATAAACACACTGATGAGTCTTTAGGTGACTGCTCTTTCCTTAATACATGTTTCCACATGGATACCTGCAA
GTATGTTCACTATGAAATTGATGCTTGCATGGATTCTGAGGCCCCTGGCAGCAAAGACCACACGCCAAGC
CAGGAGCTTGCTCTTACACAGAGTGTCGGAGGTGATTCCAGTGCAGACCGACTCTTCCCACCTCAGTGGA
TCTGTTGTGATATCCGCTACCTGGACGTCAGTATCTTGGGCAAGTTTGCAGTTGTGATGGCTGACCCACC
CTGGGATATTCACATGGAACTGCCCTATGGGACCCTGACAGATGATGAGATGCGCAGGCTCAACATACCC
GTACTACAGGATGATGGCTTTCTCTTCCTCTGGGTCACAGGCAGGGCCATGGAGTTGGGGAGAGAATGTC
TAAATCTCTGGGGGTATGAACGGGTAGATGAAATTATTTGGGTGAAGACAAATCAACTGCAACGCATCAT
TCGGACAGGCCGTACAGGTCACTGGTTGAACCATGGGAAGGAACACTGCTTGGTTGGTGTCAAAGGAAAT
CCCCAAGGCTTCAACCAGGGTCTGGATTGTGATGTGATCGTAGCTGAGGTTCGTTCCACCAGTCATAAAC
CAGATGAAATCTATGGCATGATTGAAAGACTATCTCCTGGCACTCGCAAGATTGAGTTATTTGGACGACC
ACACAATGTGCAACCCAACTGGATCACCCTTGGAAACCAACTGGATGGGATCCACCTACTAGACCCAGAT
GTGGTTGCACGGTTCAAGCAAAGGTACCCAGATGGTATCATCTCTAAACCTAAGAATTTATAG


Chromatograms CHROMATOGRAMS
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_019852
ORF Size 1743 bp
Insert Size 2460
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_019852.2, NP_062826
RefSeq Size 1975
Locus ID 56339
Cytogenetics 14q11.2
Domains MT-A70
Gene Summary This gene encodes the 70 kDa subunit of MT-A which is part of N6-adenosine-methyltransferase. This enzyme is involved in the posttranscriptional methylation of internal adenosine residues in eukaryotic mRNAs, forming N6-methyladenosine. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.