VPS24 (CHMP3) (NM_016079) Human Untagged Clone

CAT#: SC111287

Reviews ()
Write a review

CHMP3 (untagged)-Human vacuolar protein sorting 24 homolog (S. cerevisiae) (VPS24), transcript variant 1

  View "NM_016079" in other vectors (10)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name VPS24 (CHMP3) (NM_016079) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol CHMP3
Synonyms CGI-149; NEDF; VPS24
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC111287 sequence for NM_016079 edited (data generated by NextGen Sequencing)
ATGGGGCTGTTTGGAAAGACCCAGGAGAAGCCGCCCAAAGAACTGGTCAATGAGTGGTCA
TTGAAGATAAGAAAGGAAATGAGAGTTGTTGACAGGCAAATAAGGGATATCCAAAGAGAA
GAAGAAAAAGTGAAACGATCTGTGAAAGATGCTGCCAAGAAGGGCCAGAAGGATGTCTGC
ATAGTTCTGGCCAAGGAGATGATCAGGTCAAGGAAGGCTGTGAGCAAGCTGTATGCATCC
AAAGCCCACATGAACTCAGTGCTCATGGGGATGAAGAACCAGCTCGCGGTCTTGCGAGTG
GCTGGTTCCCTGCAGAAGAGCACAGAAGTGATGAAGGCCATGCAAAGTCTTGTGAAGATT
CCAGAGATTCAGGCCACCATGAGGGAGTTGTCCAAAGAAATGATGAAGGCTGGGATCATA
GAGGAGATGTTAGAGGACACTTTTGAAAGCATGGACGATCAGGAAGAAATGGAGGAAGAA
GCAGAAATGGAAATTGACAGAATTCTCTTTGAAATTACAGCAGGGGCCTTGGGCAAAGCA
CCCAGTAAAGTGACTGATGCCCTTCCAGAGCCAGAACCTCCAGGAGCGATGGCTGCCTCA
GAGGATGAGGAGGAGGAGGAAGAGGCTCTGGAGGCCATGCAGTCCCGGCTGGCCACACTC
CGCAGCTAG

Clone variation with respect to NM_016079.3
246 a=>c
>OriGene 5' read for NM_016079 unedited
ATACGACTCACTATTAGGGCGGCCGCGAATTCGCACGAGGGTTCAGTTCGTCATGGGGCT
GTTTGGAAAGACCCAGGAGAAGCCGCCCAAAGAACTGGTCAATGAGTGGTCATTGAAGAT
AAGAAAGGAAATGAGAGTTGTTGACAGGCAAATAAGGGATATCCAAAGAGAAGAAGAAAA
AGTGAAACGATCTGTGAAAGATGCTGCCAAGAAGGGCCAGAAGGATGTCTGCATAGTTCT
GGCCAAGGAGATGATCAGGTCAAGGAAGGCTGTGAGCAAGCTGTATGCATCCAAAGCCCA
CATGAACTCAGTGCTCATGGGGATGAAGAACCAGCTCGCGGTCTTGCGAGTGGCTGGTTC
CCTGCAGAAGAGCACAGAAGTGATGAAGGCCATGCAAAGTCTTGTGAAGATTCCAGAGAT
TCAGGCCACCATGAGGGAGTTGTCCAAAGAAATGATGAAGGCTGGGATCATAGAGGAGAT
GTTAGAGGACACTTTTGAAAGCATGGACGATCAGGAAGAAATGGAGGAAGAAGCAGAAAT
GGAAATTGACAGAATTCTCTTTGAAATTACAGCAGGGGCCTTGGGCAAAGCACCCAGTAA
AGTGACTGATGCCCTTCCAGAGCCAGAACCTCCAGGAGCGATGGCTGCCTCANACGATGA
GGAGGAGGAGGAAGAGGCTCTGGAGGCCATGCAGTCCCGGCTGGCCACACTCCGCAGCTA
GGGGCTGCCTACCCCGCTGGGTGTGCACACACTCCTCTCAAGAGCTGCCATTNTATGTGT
CTCTTGCACTACACCNTCTGTGTGAGGACTACCATTTTGGAGAAGGNTCTGTNTGNCTCT
TTTCATTNCTCTGCCCAGTTNNTGGGATCGCANAAGGGATNGNTCTTATNAAAGTGGCAT
AAATAAATGCATCATTTNNNTAGAGATAGACAGATTTATCTTATTNGTGGGGAGGGGAAA
GAAATNCATCTGCTCATGAAGCCTTNCTGAAAAT
>OriGene 3' read for NM_016079 unedited
NNTTTTAGCTTTGGACCGGCGGCCGCATNCTANGATCGAGTTTTTTTTTTTTTTTTTTGN
GAGAGAAGGATCTTGCTATGTTGCCCAGGCTGGTCTTGAACTCCTATTCTCAAGAGAGCC
TCCTGCCTCAGCCTTGTAAAGCACTGGGATTATAGGCATGAACCACCGCACCCAGCCAAG
ATTGCCATTTTGTATGATGAGACTGGAAGGACCCCATTGTTTCAGGATTTTGCTACAATA
TACAAAAAACAATCTGTGAGACAGTGGCTGGGCTTTTTTCCTGCCTGATTAGTTCAGTGC
ACATACAACTTGGACCAGAGGATCTGGGTTTGAATCCCATCTCTGATACTTCCCAAACTG
AGCTGTTTTCCTTATTTGTAAAGACTAAGATCGCGTATGTCAAAGAGCTCTGTAAACTCT
CAACACATACAAAGTACTACTGCTGAAATGATTTATAAATGTATCTTAAGAATGTCCCAG
ATGAGTGAATGTTGGTTATGATGCATGACCACACCTTAGTGTGCTCCTGGTCAGCTCCTG
ACTTTGAGAAAACACAGATAGGAAGGCCCATGTCCCACGCACAAGACAACCAGCTCGAAG
CAGGGACAGGCAATGAGAGGTGAAAGAGACCTAGTACTACAGCTGTCTCATCTGGGTGCA
ACTTGCAATGGGAAGGAAGGGACAGAAGCTCTAAATAGACCCACATGCACACCCCAGGAC
ATAATGCAGCCACCAGCCAACAGGACAAGCAGCACATTTCCCCAGCATCCTCTTGTTTAA
ATAGAAACAGAATGGCTGCCATACCATGTCTGTGAAAGCCGGGAGCAGCAACCACAGAGC
AAAGTCACTTCTGCTGAGCTCCCAAATCCATATGCCTGGCCTAGCAACTCTTTCCACACC
AA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_016079
ORF Size 669 bp
Insert Size 2080
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_016079.2, NP_057163.1
RefSeq Size 3174
RefSeq ORF 669
Locus ID 51652
Cytogenetics 2p11.2
Domains DUF279
Protein Pathways Endocytosis
Gene Summary This gene encodes a protein that sorts transmembrane proteins into lysosomes/vacuoles via the multivesicular body (MVB) pathway. This protein, along with other soluble coiled-coil containing proteins, forms part of the ESCRT-III protein complex that binds to the endosomal membrane and recruits additional cofactors for protein sorting into the MVB. This protein may also co-immunoprecipitate with a member of the IFG-binding protein superfamily. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ring finger protein 103 (RNF103) gene. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1, also known as Vps24alpha).

Other Versions

Other products for "CHMP3"
Frequently bought together (2)
Rabbit Polyclonal Anti-CHMP3 Antibody
    • 100 ul

USD 360.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones