EGFR (NM_005228) Human Untagged Clone

CAT#: SC110878

EGFR (untagged)-Human epidermal growth factor receptor (EGFR), transcript variant 1

USD 2,318.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name EGFR (NM_005228) Human Untagged Clone
Symbol EGFR
Synonyms ERBB; ERBB1; HER1; mENA; NISBD2; PIG61
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_005228 edited
ATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCG
GCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCACGAGTAACAAGCTCACGCAG
TTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTG
GTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAG
ACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCT
TTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCA
GTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTA
CAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAG
AGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTC
CAGAACCACCTGGGCAGCTGCCAAAAGTGTGATCCAAGCTGTCCCAATGGGAGCTGCTGG
GGTGCAGGAGAGGAGAACTGCCAGAAACTGACCAAAATCATCTGTGCCCAGCAGTGCTCC
GGGCGCTGCCGTGGCAAGTCCCCCAGTGACTGCTGCCACAACCAGTGTGCTGCAGGCTGC
ACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGC
AAGGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAAC
CCCGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTG
GTGACAGATCACGGCTCGTGCGTCCGAGCCTGTGGGGCCGACAGCTATGAGATGGAGGAA
GACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTGCCGCAAAGTGTGTAACGGAATA
GGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAA
AACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGTGACTCC
TTCACACATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGTAAAGGAA
ATCACAGGGTTTTTGCTGATTCAGGCTTGGCCTGAAAACAGGACGGACCTCCATGCCTTT
GAGAACCTAGAAATCATACGCGGCAGGACCAAGCAACATGGTCAGTTTTCTCTTGCAGTC
GTCAGCCTGAACATAACATCCTTGGGATTACGCTCCCTCAAGGAGATAAGTGATGGAGAT
GTGATAATTTCAGGAAACAAAAATTTGTGCTATGCAAATACAATAAACTGGAAAAAACTG
TTTGGGACCTCCGGTCAGAAAACCAAAATTATAAGCAACAGAGGTGAAAACAGCTGCAAG
GCCACAGGCCAGGTCTGCCATGCCTTGTGCTCCCCCGAGGGCTGCTGGGGCCCGGAGCCC
AAGGACTGCGTCTCTTGCCGGAATGTCAGCCGAGGCAGGGAATGCGTGGACAAGTGCAAC
CTTCTGGAGGGTGAGCCAAGGGAGTTTGTGGAGAACTCTGAGTGCATACAGTGCCACCCA
GAGTGCCTGCCTCAGGCCATGAACATCACCTGCACAGGACGGGGACCAGACAACTGTATC
CAGTGTGCCCACTACATTGACGGCCCCCACTGCGTCAAGACCTGCCCGGCAGGAGTCATG
GGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGC
CATCCAAACTGCACCTACGGATGCACAGGGCCAGGTCTTGAAGGCTGTCCAACGAATGGG
CCTAAGATCCCGTCCATCGCCACTGGGATGGTGGGGGCCCTCCTCTTGCTGCTGGTGGTG
GCCCTGGGGATCGGCCTCTTCATGCGAAGGCGCCACATCGTTCGGAAGCGCACGCTGCGG
AGGCTGCTGCAGGAGAGGGAGCTTGTGGAGCCTCTTACACCCAGTGGAGAAGCTCCCAAC
CAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGGGCTCC
GGTGCGTTCGGCACGGTGTATAAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATT
CCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTC
GATGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATC
TGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGAC
TATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTGCTCAACTGGTGTGTGCAG
ATCGCAAAGGGCATGAACTACTTGGAGGACCGTCGCTTGGTGCACCGCGACCTGGCAGCC
AGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCTGGCCAAA
CTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTGCCTATCAAGTGG
ATGGCATTGGAATCAATTTTACACAGAATCTATACCCACCAGAGTGATGTCTGGAGCTAC
GGGGTGACCGTTTGGGAGTTGATGACCTTTGGATCCAAGCCATATGACGGAATCCCTGCC
AGCGAGATCTCCTCCATCCTGGAGAAAGGAGAACGCCTCCCTCAGCCACCCATATGTACC
ATCGATGTCTACATGATCATGGTCAAGTGCTGGATGATAGACGCAGATAGTCGCCCAAAG
TTCCGTGAGTTGATCATCGAATTCTCCAAAATGGCCCGAGACCCCCAGCGCTACCTTGTC
ATTCAGGGGGATGAAAGAATGCATTTGCCAAGTCCTACAGACTCCAACTTCTACCGTGCC
CTGATGGATGAAGAAGACATGGACGACGTGGTGGATGCCGACGAGTACCTCATCCCACAG
CAGGGCTTCTTCAGCAGCCCCTCCACGTCACGGACTCCCCTCCTGAGCTCTCTGAGTGCA
ACCAGCAACAATTCCACCGTGGCTTGCATTGATAGAAATGGGCTGCAAAGCTGTCCCATC
AAGGAAGACAGCTTCTTGCAGCGATACAGCTCAGACCCCACAGGCGCCTTGACTGAGGAC
AGCATAGACGACACCTTCCTCCCAGTGCCTGAATACATAAACCAGTCCGTTCCCAAAAGG
CCCGCTGGCTCTGTGCAGAATCCTGTCTATCACAATCAGCCTCTGAACCCCGCGCCCAGC
AGAGACCCACACTACCAGGACCCCCACAGCACTGCAGTGGGCAACCCCGAGTATCTCAAC
ACTGTCCAGCCCACCTGTGTCAACAGCACATTCGACAGCCCTGCCCACTGGGCCCAGAAA
GGCAGCCACCAAATTAGCCTGGACAACCCTGACTACCAGCAGGACTTCTTTCCCAAGGAA
GCCAAGCCAAATGGCATCTTTAAGGGCTCCACAGCTGAAAATGCAGAATACCTAAGGGTC
GCGCCACAAAGCAGTGAATTTATTGGAGCATGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005228 unedited
GCGCCCGCCGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCC
AGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGC
CACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGA
GCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTG
CTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCACG
AGTAACAAGCTCACGCAGTTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATG
TTCAATAACTGTGAGGTGGTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTAT
GATCTTTCCTTCTTAAAGACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAAC
ACAGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAA
AATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGANAGAG
CTGCCCATGAGAAATNTACAGGAAATCCTGCATGGCGCCGTGCGGGTCAGCAACANCCCT
GCCCTGTGNCACGTGGAGAGCATNCCTTGGCGGGACATAGTCAGCAGTGACTTTCTAGCC
ACATGTCGATGGACTTTCAGAACCACTGGGCAGCTGCCAAAGTGTGATCCAAGCTGTCCC
ATGGGAGCTGCTGGGGTGCAAGAGAAGAAACTGCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005228 unedited
GCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTCAAATATACCTCTTTGAAAG
ATAAATTTCTGCTCAAAGGACAATATTCTTGCTGGATGCGTTTCTGTAAATGCTTCACAG
TTTGAAGACAAAGGAATGCAACTTCCCAAAATGTGCCCGAGGTGGAAGTACTTCCTGGCT
AGTCGGTGTAAACGTTGCAAAACCAGTCTGTGGGTCTAAGAGCTAATGCGGGCATGGCTG
TTGGGATGGAGGACCTGCTGTGGCTTGGTCCTGGGTATCGAAAGAGTCTGGATTTTTAGG
GCTCATACTATCCTCCGTGGTCATGCTCCATTAAATCCACTGCTTTGCGGCGCGACCCTT
AAGTATCCTGCTTCTTCAGCTGGGGAGCCTTTAAAGATGCCTTTTCGCTCGCCTCCCTCG
CAAAAAACATCTTGTCTGCACCCAGCCTCCCCCACGTTACTTGCCGGCTCTCCTTCTGCC
CCCCCTTACCGCCCTCTCTTCCCCCCTTTCTTTTTTTCTGACTGCATCTTCCTCGTATTT
TCCCTTTCCATTTTTCCCTTTCCTCTCCTCCCCTTCCCTCTTCCTTTCTTTCTTTTCTCC
CCTCTCTCCCACTCTGTCCTTTGACTCATCCTTCTCCCTTTTCTTTCCTATTTCCCCCCC
CCCTCATTTTTTATCCCATCTCCCCCCTCCTTCTCCTCCCCCCCTTTTTTTTCTCTTCTC
CTCTCTCCTTTCACTTTTCATTTTTTTCCTCCCCCTTATTCCTCTTTCTTCCCCACCCTT
TCCTTTTCTTTCATATCCCTCCCCTCGCACCCCTTCCTTCTTTCCTCCACCCCTCCTCTC
CTTATTTCCTTTTTTTCCTTCCTCCCTCTTTCTTGTTCCTCTATTTCTCTCTCCCCCCGC
TCTTCCTCCCTCGAATCCTATCCTTTCTCTTTCATTTCCCTATTACTTNATCTCTTTCCC
TCCCCTTTCCCTCCTCCCCATTATTCTCTCCCCCTTNTTTTTTTTATTTCCCTCCCCCA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005228
ORF Size 3633 bp
Insert Size 4000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005228.3, NP_005219
RefSeq Size 5616
Locus ID 1956
Cytogenetics 7p11.2
Domains Recep_L_domain, pkinase, TyrKc, S_TKc, Furin-like, FU
Protein Families Stem cell relevant signaling - JAK/STAT signaling pathway, Protein Kinase, Secreted Protein, ES Cell Differentiation/IPS, Transmembrane, Adult stem cells, Cancer stem cells, Druggable Genome
Protein Pathways MAPK signaling pathway, ErbB signaling pathway, Calcium signaling pathway, Cytokine-cytokine receptor interaction, Endocytosis, Dorso-ventral axis formation, Focal adhesion, Adherens junction, Gap junction, Regulation of actin cytoskeleton, GnRH signaling pathway, Epithelial cell signaling in Helicobacter pylori infection, Pathways in cancer, Colorectal cancer, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Bladder cancer, Non-small cell lung cancer
Gene Summary Isoform 2 may act as an antagonist of EGF action. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) is the longest transcript and it encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations