E2F3 (NM_001949) Human Untagged Clone

CAT#: SC110876

E2F3 (untagged)-Human E2F transcription factor 3 (E2F3)

USD 742.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name E2F3 (NM_001949) Human Untagged Clone
Symbol E2F3
Synonyms E2F-3
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC110876 sequence for NM_001949 edited (data generated by NextGen Sequencing)
ATGAGAAAGGGAATCCAGCCCGCTCTGGAGCAGTACCTGGTGACCGCCGGGGGTGGGGAG
GGGGCGGCTGTCGTCGCCGCCGCCGCTGCAGCCTCCATGGACAAAAGGGCACTGCTAGCC
AGCCCCGGCTTCGCCGCCGCCGCCGCCGCTGCCGCCGCCCCGGGCGCGTACATCCAGATC
CTCACCACGAACACTTCCACCACCTCCTGTTCCTCCTCCCTCCAAAGCGGCGCCGTAGCC
GCCGGCCCCCTCCTCCCCAGTGCCCCCGGCGCGGAGCAGACCGCCGGCAGCCTCCTCTAC
ACCACGCCGCACGGACCCTCCAGCAGAGCCGGGCTGCTGCAGCAGCCACCAGCGCTGGGA
CGCGGCGGCAGCGGCGGCGGCGGCGGCCCTCCGGCAAAGCGAAGGCTGGAGCTAGGAGAA
AGCGGTCATCAGTACCTCTCAGATGGTTTAAAAACCCCCAAGGGCAAAGGAAGAGCTGCA
CTACGAAGTCCAGATAGTCCAAAAACTCCAAAATCTCCCTCAGAAAAAACGCGGTATGAT
ACGTCTCTTGGTCTGCTCACCAAGAAGTTCATTCAGCTCCTGAGCCAGTCACCCGATGGG
GTATTGGATTTGAACAAGGCAGCAGAAGTGCTAAAAGTGCAAAAGAGAAGGATTTATGAT
ATCACCAACGTTCTGGAAGGCATCCACCTCATTAAGAAGAAGTCTAAAAACAACGTCCAA
TGGATGGGCTGCAGTCTGTCTGAGGATGGGGGCATGCTGGCCCAGTGTCAAGGCCTGTCA
AAAGAAGTGACCGAGCTCAGTCAGGAAGAGAAGAAATTAGATGAACTGATCCAAAGCTGC
ACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAGAATCAAAGGTTAGCTTATGTTACA
TATCAAGATATTCGAAAAATTAGTGGCCTTAAAGACCAAACTGTTATAGTTGTGAAAGCC
CCTCCAGAAACAAGACTTGAAGTGCCTGACTCAATAGAGAGCCTACAAATACATTTGGCA
AGTACCCAAGGGCCCATTGAGGTTTACTTATGTCCAGAAGAGACTGAAACACACAGTCCA
ATGAAAACAAACAACCAAGACCACAATGGGAATATCCCTAAACCCGCTTCCAAAGACTTG
GCTTCAACCAACTCAGGACATAGCGATTGCTCAGTTTCTATGGGAAACCTTTCTCCTCTG
GCCTCCCCAGCCAACCTCTTACAGCAGACTGAGGACCAAATTCCTTCCAACCTAGAAGGA
CCGTTTGTGAACTTACTGCCTCCCCTGCTGCAAGAGGACTATCTCCTGAGCCTCGGGGAG
GAGGAAGGCATCAGCGATCTCTTCGATGCTTACGATTTGGAAAAGCTCCCACTGGTGGAA
GACTTCATGTGTAGTTGA

Clone variation with respect to NM_001949.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001949 unedited
GGGTACTATTTTGTATACGACTCACTATAGGGCGGCCGCGAATTCGCACCGAGGGAAAAC
AATACATTAATATACCATAACACTAAAAAGAGCAGGAGCGAGAGATGAGAAAGGGAATCC
AGCCCGCTCTGGAGCAGTACCTGGTGACCGCCGGGGGTGGGGAGGGGGCGGCTGTCGTCG
CCGCCGCCGCTGCATCCTCCATGGACAAAAGGGCACTGCTAGCCAGCCCCGGCTTCGCCG
CCGCAGACCCTCATGACTCAACTTCTCCTCCTGCTACAGGCACCATATCACATCAAGCCC
CATCCCTCTCTGCCTAGATCATACTTTCTCTCTTCCTCTCCCAACTACCTATCACTACGT
TCCATCTCTAATTCAATTTGCGCACTCCACCAGATACCAACCCCTCCCACCGCTTCCCTA
CCTCTCACCTCCTCAACCTTATCATTTTCTTTTACACAATCATCATCTTCTAACCCGCAC
GATCCCCGTTCCCATACACTTTCACAACCCCTCTGACCGCCTCACCACTCACTCCTCGCT
ACCATTGCTTCCCTTCTCCCCTTTTTACTACACTTCACTCCTCTTCTCTCTATCCATCTT
AGCTCCCCTCTTTTTTACCTTATCCATACCTCTATTTCACTCCTCTCTTATGATTTTTTT
CTTTTTTCTCCCATAACTATTTTCCTCTCCCCTTCCCTCACTCCCCTTCCTTTTACCTAC
TCCGCACCCACTTTACTACTCCCCTCCTCAACACGCTCATTACTTCTCCTTCATTACGTG
GTTTTCGTCCTCTTNTCCATCCTTTCCCTCTGTATTCCCAGTAGTTACTCCTCCTCTCTC
CCCTACACAACTTTCCATCACCCANAAACACACACCCTCAGGCTCTTACTAGGCTCACCT
CCTCAACTCTTATACCCTCACATTTTCATCCCCTTACACCTCTCTCTCCTCCTTCTGTTC
TCATCCTCCCTCTCTTCTCCCCNTCTTGTCTATCCCACCTCCCTACGTGCTCCTTTCCGT
ATCCTTTCCTCTCCTATATCTCCCACCGATCTC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001949 unedited
CAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTCCTAAGGATATTTTCAATTCAATTAAA
CATATGAGTTGAGTGCCTACTATGTGCCTACCATTGGGTCAGGCACATAGCATTTCAATT
TAACTGTTCGTTTCGAGGTTTGTTCTTTATCTGACTCCCTCATTCCCGCAGTCCTTATCA
TCCAAGGAATGGACCGGAGATACTACGCCATATTCCCAGTGGGAGATGGCCGCTGCCACC
TGCCCGAGGGAAAGCCATTCTTGGACATAACTGGTAGGATTTGCAGCTGACACAAAGCCT
CCAACTTGGGACACCATTCCTGAAGAGTAAAGCGGGAGACACCCTGGCATTGTTTTGCTT
CATTTTTTACGTCCCCGACTTCCCTTGGTCCAACTTATTCCTTCATAGAGGAAGGGGAAC
GGGGTCTGGCCAGAACTATTCCAGCCCCCGACACAGGGCTGCTCCCTGTTCCTGCCAGCT
TAAGGAAATGCCACTCACACAATGGGGATGTCTTTCTCCCTAGAGGTCTCTCCATCTGAC
CCCATCCTGAGAAGTGGTCTCCCTGAGTGCGGTGTAAGAGAGCCCTTTCCCCTGTCACAG
GGGCCCCGGGAAGCCCAAGGATGGAGGGACCCATGCCTGCTGCTCCTTGAGGCTGTTACA
TCATCTGACCTGGTTCTCCTTTCCATGGGCCACCCATGTCAGCAAGCCCCATGACTGACT
CGCTCCAAGCTCCCCCTNCTGGGAATGGNAGCACGATGGGACAAAGCTCCTTGCAGGAGC
TGANTAACCCTANATCACACAGGTCTTAGATGCTCTGATCAGTAAAGGNTCTCTCCCTCT
GCCTAATAATATGAATTNGCAAAACCCGCCTCAAAGTAAACATTTAAATCGGAATGGGGG
ATGGCTGCCCCAGGAAGATGCTAATGGCACGCTAAAAAATTTAAAGCCTAGAACATCCCA
AAAGAACTTAGTAGGCGTTTGCTACAATCANCTGGACTNCCAAACCATGGGGACGGGGAA
TGGNATGGTCATGAAACG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001949
ORF Size 1398 bp
Insert Size 3150
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001949.2, NP_001940
RefSeq Size 4744
Locus ID 1871
Cytogenetics 6p22.3
Domains E2F_TDP
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Cell cycle, Pathways in cancer, Pancreatic cancer, Glioma, Prostate cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer
Gene Summary This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (1, also known as a) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations