MRPL43 (NM_176793) Human Untagged Clone

SKU
SC110693
MRPL43 (untagged)-Human mitochondrial ribosomal protein L43 (MRPL43), nuclear gene encoding mitochondrial protein, transcript variant 3
$300.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MRPL43
Synonyms bMRP36a; L43mt; MRP-L43
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_176793, the custom clone sequence may differ by one or more nucleotides


ATGACGGCGCGCGGGACTCCGAGCCGCTTCTTGGCCAGCGTTCTCCACAACGGACTGGGTCGCTATGTGC
AGCAGCTGCAGCGTCTGAGCTTCAGCGTCAGCCGCGACGGCGCCTCGTCTCGCGGCGCCAGGGAGTTCGT
GGAGCGGGAGGTGATCGACTTCGCCCGACGGAATCCAGGGGTCGTAATATATGTAAACTCGCGTCCGTGC
TGCGTGCCCAGAGTAGTGGCCGAATACCTTAACGGGGCTGTGCGCGAGGAGAGCATCCACTGCAAGTCGG
TCGAGGAGATCTCGACGCTGGTGCAGAAGCTGGCCGACCAGTCGGGCTTGGACGTGATCCGCATCCGCAA
GCCCTTCCACACCGACAACCCTAGCATCCAGGGCCAGTGGCACCCCTTCACCAACAAGCCGACCACGTTC
CGCGGGCTACGCCCCCGAGAGGTTCAGGATCCTGCCCCAGCCCAGGACACTGGCCTGAGACTGTCTGCAG
TTGCACCGCAGATCCTCCTGCCCGGCTGGCCCGACCCAATATCAGTTCAGTCATCCGATCTTCCTTGGGG
AAATACCCATTACCGTCCTGAACCCTTGTCATCCACTACTTGGCTATAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_176793 unedited
GGGGGGGGGGGGGNNNNNNNNNCTCCCCCCCCNCGGTTCAGATTTGNATACGACTCACTA
TAGGCGGCCGCGNATATCGCACCAGGCTCCGCGGCCTCCAAGCTGTAGCTATGACGGCGC
GCGGGACTCCGAGCCGCTTCTTGGCCAGCGTTCTCCACAACGGACTGGGTCGCTATGTGC
AGCAGCTGCAGCGTCTGAGCTTCAGCGTCAGCCGCGACGGCGCCTCGTCTCGCGGCGCCA
GGGAGTTCGTGGAGCGGGAGGTGATCGACTTCGCCCGACGGAATCCAGGGGTCGTAATAT
ATGTAAACTCGCGTCCGTGCTGCGTGCCCAGAGTAGTGGCCGAATACCGTGAGTGGGGCC
GGGCTCGGGCTGGAGGGCGGGATCAGGGGCTCGACCCGCTATCCTCCTTCTCGCTTGGTC
GCACCGGCCAGCTTCCACCCACTCTCACCCCTCTTCTGCCAGTTAACGGGGCTGTGCGCG
AGGAGAGCATCCACTGCAAGTCGGTCGAGGAGATCTCGACGCTGGTGCAGAAGCTGGCCG
ACCAGTCGGGCTTGGACGTGATCCGCATCCGCAAGCCCTTCCACACCGACAACCCTAGCA
TCCAGGGCCAGTGGCACCCCTTCACCAACAAGCCGACCACGTTCCGCGGGCTACGCCCCC
GAGAGGTTCAGGATCCTGCCCCAGCCCAGGTGCAAGCACAGTGAAGAGTTGCCCCACCAA
CTGCAGCCCCAGGCTTTGGACTGTTACTCCGGTAAAGGTGGTTCTTCCCCTTTGGGATTC
CAAGCCCAGGGCAATGGAACCCATCATGGGGCAANGTGACAGAGTTCTGCTTGGGATAAT
GAAGAGCTGCCTGGTTCTTTCCAGTGCCTGCTTCTGGGGGCAGTGACCCTGTGAACCACT
CATTTTATGCAAGTGGCATCCCTAAAACTGAGATN
Restriction Sites NotI-NotI
ACCN NM_176793
Insert Size 3500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_176793.1, NP_789763.1
RefSeq Size 767 bp
RefSeq ORF 609 bp
Locus ID 84545
UniProt ID Q8N983
Cytogenetics 10q24.31
Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. This gene and the gene for a semaphorin class 4 protein (SEMA4G) overlap at map location 10q24.31 and are transcribed in opposite directions. Sequence analysis identified multiple transcript variants encoding at least four different protein isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 3' UTR and has multiple coding region differences, compared to variant 1. This results in a longer isoform (c) with a distinct C-terminus compared to isoform a.
Write Your Own Review
You're reviewing:MRPL43 (NM_176793) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208799 MRPL43 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L43 (MRPL43), nuclear gene encoding mitochondrial protein, transcript variant 3 10 ug
$330.00
RC208799L3 Lenti-ORF clone of MRPL43 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L43 (MRPL43), nuclear gene encoding mitochondrial protein, transcript variant 3 10 ug
$630.00
RC208799L4 Lenti-ORF clone of MRPL43 (mGFP-tagged)-Human mitochondrial ribosomal protein L43 (MRPL43), nuclear gene encoding mitochondrial protein, transcript variant 3 10 ug
$630.00
RG208799 MRPL43 (tGFP-tagged) - Human mitochondrial ribosomal protein L43 (MRPL43), nuclear gene encoding mitochondrial protein, transcript variant 3 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.