WTAP (NM_152858) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | WTAP |
Synonyms | Mum2 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_152858, the custom clone sequence may differ by one or more nucleotides
ATGACCAACGAAGAACCTCTTCCCAAGAAGGTTCGATTGAGTGAAACAGACTTCAAAGTTATGGCAAGAG ATGAGTTAATTCTAAGATGGAAACAATATGAAGCATATGTACAAGCTTTGGAGGGCAAGTACACAGATCT TAACTCTAATGATGTAACTGGCCTAAGAGAGTCTGAAGAAAAACTAAAGCAACAACAGCAGGAGTCTGCA CGCAGGGAAAACATCCTTGTAATGCGACTAGCAACCAAGGAACAAGAGATGCAAGAGTGTACTACTCAAA TCCAGTACCTCAAGCAAGTCCAGCAGCCGAGCGTTGCCCAACTGAGATCAACAATGGTAGACCCAGCGAT CAACTTGTTTTTCCTAAAAATGAAAGGTGAACTGGAACAGACTAAAGACAAACTGGAACAAGCCCAAAAT GAACTGAGTGCCTGGAAGTTTACGCCTGATAGGTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_152858 unedited
NGGGGTGCGGGCATTTTGTACACGTTTACTATAGGGCGGCCGCGATTCGGCACGAGCTTT CCTCTCCTGGCGGGGTTCGGCGGCGGGCGAGTGACTGCGGCCACGCCTGAAAGGCGACTC TCCTGATTCAAGATGACCAACGAAGAACCTCTTCCCAAGAAGGTTCGATTGAGTGAAACA GACTTCAAAGTTATGGCAAGAGATGAGTTAATTCTTATATGGAAACAATATGAAGCATAT GTACAAGCTTTGGAGGGCAAGTACACAGATCTTAACTCTAATGATGTAACTGGCCTAAGA GAGTCTGAAGAAAAACTAAAGCAACAACAGCAGGAGTCTGCACGCAGGGAAAACATCCTT GTAATGCGACTAGCAACCAAGGAACAAGAGATGCAAGAGTGTACTACTCAAATCCAGTAC CTCAAGCAAGTCCAGCAGCCGAGCGTTGCCCAACTGAGATCAACAATGGTAGACCCAGCG ATCAACTTTGTTTTCCTAAAAATGAAAGGTGAACTGGAACAGACTAAAGACAAACTGGAA CAAGCCCAAAATGAACTGAGTGCCTGGAAAGTTACGCCTGATAGGTAAACAAATCATACT CCCCAGTCAAAACTTCCCTGACAGTCCCACTACGAGAAAAGCTTGGGGGGGACAAGCAAA GTCTTCGTTTCCCCCCCAAGACTCAAACTTTTTGAGCCCCCCTCGAAAAATTTCCCTTCT TAAACATGTAACCCCTTAAAAAAGTTCTGGTTGAAAAAAATGGGGGGGAAACATAATCTT AAATCTTGGGGACACTGGGCTTTCCACCGTTTTGAGGTAGGAAACCCCAGGTTTTAAACC TGAAATTGACCTGTTAAAATCCCGTAAAAGTGAAACGGGAATGCCTCCCTTTTAACTTTG CCATATGCT |
Restriction Sites | NotI-NotI |
ACCN | NM_152858 |
Insert Size | 1500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_152858.1, NP_690597.1 |
RefSeq Size | 1742 bp |
RefSeq ORF | 456 bp |
Locus ID | 9589 |
UniProt ID | Q15007 |
Cytogenetics | 6q25.3 |
Protein Families | Druggable Genome |
Summary | The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (3) has an alternate 3' end sequence compared to variant 1, that causes a frameshift and immediate translation termination. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Variants 2 and 3 both encode the same isoform (2). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC223099 | WTAP (Myc-DDK-tagged)-Human Wilms tumor 1 associated protein (WTAP), transcript variant 3 | 10 ug |
$150.00
|
|
RC223099L3 | Lenti ORF clone of Human Wilms tumor 1 associated protein (WTAP), transcript variant 3, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC223099L4 | Lenti ORF clone of Human Wilms tumor 1 associated protein (WTAP), transcript variant 3, mGFP tagged | 10 ug |
$450.00
|
|
RG223099 | WTAP (tGFP-tagged) - Human Wilms tumor 1 associated protein (WTAP), transcript variant 3 | 10 ug |
$350.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.