RAC1 (NM_018890) Human Untagged Clone

SKU SC109694

RAC1 (untagged)-Human ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) (RAC1), transcript variant Rac1b

Product Data

• Type: Human Untagged Clone
• Target Symbol: RAC1
• Synonyms: MIG5; MRD48; p21-Rac1; Rac-1; TC-25
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_018890 edited; GTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCGCGGAGGGCGAGGCGGCGTGGACAGC; GGCCCCGGCACCCAGCGCCCCGCCGCCCGCAAGCCGCGCGCCCGTCCGCCGCGCCCCGAG; CCCGCCGCTTCCTATCTCAGCGCCCTGCCGCCGCCGCCGCGGCCCAGCGAGCGGCCCTGA; TGCAGGCCATCAAGTGTGTGGTGGTGGGAGACGGAGCTGTAGGTAAAACTTGCCTACTGA; TCAGTTACACAACCAATGCATTTCCTGGAGAATATATCCCTACTGTCTTTGACAATTATT; CTGCCAATGTTATGGTAGATGGAAAACCGGTGAATCTGGGCTTATGGGATACAGCTGGAC; AAGAAGATTATGACAGATTACGCCCCCTATCCTATCCGCAAACAGTTGGAGAAACGTACG; GTAAGGATATAACCTCCCGGGGCAAAGACAAGCCGATTGCCGATGTGTTCTTAATTTGCT; TTTCCCTTGTGAGTCCTGCATCATTTGAAAATGTCCGTGCAAAGTGGTATCCTGAGGTGC; GGCACCACTGTCCCAACACTCCCATCATCCTAGTGGGAACTAAACTTGATCTTAGGGATG; ATAAAGACACGATCGAGAAACTGAAGGAGAAGAAGCTGACTCCCATCACCTATCCGCAGG; GTCTAGCCATGGCTAAGGAGATTGGTGCTGTAAAATACCTGGAGTGCTCGGCGCTCACAC; AGCGAGGCCTCAAGACAGTGTTTGACGAAGCGATCCGAGCAGTCCTCTGCCCGCCTCCCG; TGAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAAATGTCTCAGCCCCTCGTTCTTGGTC; CTGTCCCTTGGAACCTTTGTACGCTTTGCTCAAAAAAAAAAA;
• Restriction Sites: Please inquire
• ACCN: NM_018890
• Insert Size: 900 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_018890.2.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_018890.2, NP_061485.1
• RefSeq Size: 2412 bp
• RefSeq ORF: 636 bp
• Locus ID: 5879
• UniProt ID: P63000
• Cytogenetics: 7p22.1
• Domains: ras
• Protein Families: Druggable Genome
• Protein Pathways: Adherens junction, Amyotrophic lateral sclerosis (ALS), Axon guidance, B cell receptor signaling pathway, Chemokine signaling pathway, Colorectal cancer, Epithelial cell signaling in Helicobacter pylori infection, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Leukocyte transendothelial migration, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Pancreatic cancer, Pathways in cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, Toll-like receptor signaling pathway, VEGF signaling pathway, Viral myocarditis, Wnt signaling pathway
• Summary: The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]; Transcript Variant: This variant (Rac1b) includes the alternatively spliced 57 bp region (exon 3b) that is missing in transcript variant Rac1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.