CDA08 (ITFG1) (NM_030790) Human Untagged Clone

CAT#: SC109513

Reviews ()
Write a review

ITFG1 (untagged)-Human integrin alpha FG-GAP repeat containing 1 (ITFG1)



  "NM_030790" in other vectors (6)

Reconstitution Protocol

USD 571.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "ITFG1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ITFG1
Synonyms 2310047C21Rik; CDA08; LNKN-1; TIP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_030790 edited
GAATTCGGCACGAGGCGGAAGGGCAGCCCTAGTGGGAGAGAGAAAAAGGAGCCGGCAGCG
GCTCTTACGCGTCCCGGGGCTGCGCGCCACTCTCTCGGCCGGTAACGCGGTGCTTTGCGG
CTGTCGTCAAGCGCGGCGTTGGGCCGGCGGGCGGGGGCTGAGGGGCTGCCATGGCGGCGG
CGGGCCGGCTCCCGAGCTCCTGGGCCCTCTTCTCGCCGCTCCTCGCAGGGCTTGCACTAC
TGGGAGTCGGGCCGGTCCCAGCGCGGGCGCTGCACAACGTCACGGCCGAGCTCTTTGGGG
CCGAGGCCTGGGGCACCCTTGCGGCTTTCGGGGACCTCAACTCCGACAAGCAGACGGATC
TCTTCGTGCTGCGGGAAAGAAATGACTTAATCGTCTTTTTGGCAGACCAGAATGCACCCT
ATTTTAAACCCAAAGTAAAGGTATCTTTCAAGAATCACAGTGCATTGATAACAAGTGTAG
TCCCTGGGGATTATGATGGAGATTCTCAAATGGATGTCCTTCTGACATATCTTCCCAAAA
ATTATGCCAAGAGTGAATTAGGAGCTGTTATCTTCTGGGGACAAAATCAAACATTAGATC
CTAACAATATGACCATACTCAATAGGACTTTTCAAGATGAGCCACTAATTATGGATTTCA
ATGGTGATCTAATTCCTGATATTTTTGGTATCACAAATGAATCCAACCAGCCACAGATAC
TATTAGGAGGGAATTTATCATGGCATCCAGCATTGACCACTACAAGTAAAATGCGAATTC
CACATTCTCATGCATTTATTGATCTGACTGAAGATTTTACAGCAGATTTATTCCTGACGA
CATTGAATGCCACCACTAGTACCTTCCAGTTTGAAATATGGGAAAATTTGGATGGAAACT
TCTCTGTCAGTACTATATTGGAAAAACCTCAAAATATGATGGTGGTTGGACAGTCAGCAT
TTGCAGACTTTGATGGAGATGGACACATGGATCATTTACTGCCAGGCTGTGAAGATAAAA
ATTGCCAAAAGAGTACCATCTACTTAGTGAGATCTGGGATGAAGCAGTGGGTTCCAGTCC
TACAAGATTTCAGCAATAAGGGCACACTCTGGGGCTTTGTGCCATTTGTGGATGAACAGC
AACCAACTGAAATACCAATTCCAATTACCCTTCATATTGGAGACTACAATATGGATGGCT
ATCCAGACGCTCTGGTCATACTAAAGAACACATCTGGAAGCAACCAGCAGGCCTTTTTAC
TGGAGAACGTCCCTTGTAATAATGCAAGCTGTGAAGAGGCGCGTCGAATGTTTAAAGTCT
ACTGGGAGCTGACAGACCTAAATCAAATTAAGGATGCCATGGTTGCCACCTTCTTTGACA
TTTACGAAGATGGAATCTTGGACATTGTAGTGCTAAGTAAAGGATATACAAAGAATGATT
TTGCCATTCATACACTAAAAAATAACTTTGAAGCAGATGCTTATTTTGTTAAAGTTATTG
TTCTTAGTGGTCTGTGTTCTAATGACTGTCCTCGTAAGATAACACCCTTTGGAGTGAATC
AACCTGGACCTTATATCATGTATACAACTGTAGATGCAAATGGGTATCTGAAAAATGGAT
CAGCTGGCCAACTCAGCCAATCCGCACATTTAGCTCTCCAACTACCATACAACGTGCTTG
GTTTAGGTCGGAGCGCAAATTTTCTTGACCATCTCTACGTTGGTATTCCCCGTCCATCTG
GAGAAAAATCTATACGAAAACAAGAGTGGACTGCAATCATTCCAAATTCCCAGCTAATTG
TCATTCCATACCCTCACAATGTCCCTCGAAGTTGGAGTGCCAAACTGTATCTTACACCAA
GTAATATTGTTCTGCTTACTGCTATAGCTCTCATCGGTGTCTGTGTTTTCATCTTGGCAA
TAATTGGCATTTTACATTGGCAGGAAAAGAAAGCAGATGATAGAGAAAAACGACAAGAAG
CCCACCGGTTTCATTTTGATGCTATGTGACTTGCCTTTAATATTACATAATGGAATGGCT
GTTCACTTGATTAGTTGAAACACAAATTCTGGCTTGAAAAAATAGGGGAGATTAAATATT
ATTTATAAATGATGTATCCCATGGTAATTATTGGAAAGTATTCAAATAAATATGGTTTGA
ATATGTCACAAGGTCTTTTTTTTTAAAGCACTTTGTATATAAAAATTTGGGTTCTCTATT
CTGTAGTGCTGTACATTTTTGTTCCTTTGTGGAATGTGTTGCATGTACTCCAGTGTTTGT
GTATTTATAATCTTATTTGCATCATGATGATGGAAAAAGTTGTGTAAATAAAAATAATTA
AATGAGCAGGAATTTTTGTGTCCACTTGACTTGGTCTTGCTTCTTATTCTAATGATGCAA
ATTATACTTTTGXXXXXXXXXXXXXXXXXXXXXXXXTTTTCTTGTTTATTCAGTGGGGCT
AATACTTGAGTTACTGTAAACATTAAATGGGATGATGTATGTGAAGTGCTTAGCTTGGTG
CCTAGCACAGAGTAAGTGGTCAATATGTGGTAGTTGTCATTATTAATATTTTAGATGATC
TTATTAGACTTATACATCTAATTATAGAAATACATAGACTTGATAGAATTTTATTTTCAG
GCATGAAGAAATATTCTTTGGAAAAGCTAAATTTTTGGTGATTGACATAAAGATTTACTT
GCTCATATTAACTAAAAATTATAGTACTCTCCAAGAATTAATGTGCCCTAAAAATTTTCC
TCCAAAAACTTATCCTTATCATGTGATAATGAAGAACATTTGATTTCTTGAAAGGAAACT
GCTGTAGGCAGCATCTGGGAATGCAAATCTTCAATCACATTTCTATTCTCAAACACTTGG
AGAAGTCTATAATTTACATTCAGACTTCAATGCAAATTTTGTATTGTGAACTTCACATTT
CCAAAAAGTTACTTTAAAAAGACTTTAAGACTGAAAAAAAAAAGTTTATCAATGCTAATA
ATTTTCTAGTATGCAAATGGACATGTGATGCCTATAAAACACAAAAATTTCTCTGAAAAC
AATTTTGTTCTTATTTTTTTCTTTATAGTTCACTGAGATTGGCATGTGTTTTTACTTTGT
ATCTAAGCATGTTAACATGTCTTCTTAATAAATATTCCTTATTGAAACAAAAAAAAAAAA
AAAAAACTCGAC
>OriGene 5' read for NM_030790 unedited
CATATTTGTAAACGACTCACTATAGGGNNCGGCCGCGCAATTCGGCACGAGGGCGGAGGG
CAGCCCTAGTGGGAGAGAGAAAAAGAGCCGGCAGCGGCTCTTACGCGTCCCGGGGCTGCG
CGCCACTCTCTCGGCCGGTAACGCGGTGCTTTGCGGCTGTCGTCAAGCGCGGCGTTGGGC
CGGCGGGCGGGGGCTGAGGGGCTGCCATGGCGGCGGCGGGCCGGCTCCCGAGCTCCTGGG
CCCTCTTCTCGCCGCTCCTCGCAGGGCTTGCACTACTGGGAGTCGGGCCGGTCCCAGCGC
GGGCGCTGCACAACGTCACGGCCGAGCTCTTTGGGGCCGAGGCCTGGGGCACCCTTGCGG
CTTTCGGGGACCTCAACTCCGACAAGCAGACGGATCTCTTCGTGCTGCGGGAAAGAAATG
ACTTAATCGTCTTTTTGGCAGACCAGAATGCACCCTATTTTAAACCCAAAGTAAAGGTAT
CTTTCAAGAATCACAGTGCATTGATAACAAGTGTAGTCCCTGGGGATTATGATGGAGATT
CTCAAATGGATGTCCTTCTGACATATCTTCCCACAAATTATGCCAAGAGTGAATTTACGA
GCTGTTATCTTCTGCGGACANAATCAAACATTAGATCCTAACAATATGACCATACTCAAT
AGGACTTTTCAAGATGAGCCACTTAATTATGCATTTCAATGGTGATCTAATTCCTGATAT
TTTTGGTATCACAAATGAATCCCACCAGCCACAGAAACTATTANGAGGAAATTTATCATG
GCATTCAGCCTTGACCACTACAAGTTAAATGCGAATCCCACAATTTTATGCATTTATTGA
CCGGACTGAAAATTTTACCGCAGATCTTATTCCTGACGAACTTGGATGGCACCACTATAA
CTTTCCATTGGAAAATGGAAAAATTGGAAGAAACTCCTTTGTCGACCAAAT
>OriGene 3' read for NM_030790 unedited
GGCACGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGTTTCAATAAGGAATATTTAT
TAAGAAGACATGTTAACATGCTTAGATACAAAGTAAAAACACATGCCAATCTCAGTGAAC
TATAAAGAAAAAAATAAGAACAAAATTGTTTTCAGAGAAATTTTTGTGTTTTATAGGCAT
CACATGTCCATTTGCATACTAGAAAATTATTAGCATTGATAAACTTTTTTTTTTCAGTCT
TAAAGTCTTTTTAAAGTAACTTTTTGGAAATGTGAAGTTCACAATACAAAATTTGCATTG
AAGTCTGAATGTAAATTATAGACTTCTCCAAGTGTTTGAGAATAGAAATGTGATTGAAGA
TTTGCATTCCCAGATGCTGCCTACAGCAGTTTCCTTTCAAGAAATCAAATGTTCTTCATT
ATCACATGATAAGGATAAGTTTTTGGAGGAAAATTTTTAGGGCACATTAATTCTTGGAGA
GTACTATAATTTTTAGTTAATATGAGCAAGTAAATCTTTATGTCAATCACCAAAAATTTA
GCTTTTCCAAAGAATATTTCTTCATGCCTGAAAATAAAATTCTATCAAGTCTATGTATTT
CTATAATTAGATGTATAAGTCTAATAAGATCATCTAAAATATTAATAATGACAACTACCA
CATATTGACCACTTACTCTGTGCTAAGCACCAAGCTAAGCACTTCACATACATCATCCCA
TTTAATGTTTACAGTAACTCAAGTATTAGCCCCACTGAATAAACAGGAAAACTGAGGTTT
ACAGAGGTTTAACAAAGAGCCAGTTCANACAATGACTTTTGTAGTGGGTGAATTANGAGT
TTAAGGCAGTCTGTCTTACGGTGCTACCAGTCAGATACCCGATCACTTATTGNATGCATC
AGTGAGACCCTGACCTGCTGGATGAGCTGAATGCTAATGACTCGGAATATTCACAAGTGT
ATTTGCTCATAGATTAGAGCAG
Restriction Sites NotI-NotI     
ACCN NM_030790
Insert Size 3580 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030790.2, NP_110417.2
RefSeq Size 2262 bp
RefSeq ORF 1839 bp
Locus ID 81533
UniProt ID Q8TB96
Cytogenetics 16q12.1
Domains FG-GAP
Protein Families Secreted Protein, Transmembrane
Gene Summary Modulator of T-cell function. Has a protective effect in graft versus host disease model (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.