PSGR (OR51E2) (NM_030774) Human Untagged Clone

SKU
SC109424
OR51E2 (untagged)-Human olfactory receptor, family 51, subfamily E, member 2 (OR51E2)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PSGR
Synonyms HPRAJ; OR51E3P; OR52A2; PSGR
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_030774 edited
ATGAGTTCCTGCAACTTCACACATGCCACCTTTGTGCTTATTGGTATCCCAGGATTAGAG
AAAGCCCATTTCTGGGTTGGCTTCCCCCTCCTTTCCATGTATGTAGTGGCAATGTTTGGA
AACTGCATCGTGGTCTTCATCGTAAGGACGGAACGCAGCCTGCACGCTCCGATGTACCTC
TTTCTCTGCATGCTTGCAGCCATTGACCTGGCCTTATCCACATCCACCATGCCTAAGATC
CTTGCCCTTTTCTGGTTTGATTCCCGAGAGATTAGCTTTGAGGCCTGTCTTACCCAGATG
TTCTTTATTCATGCCCTCTCAGCCATTGAATCCACCATCCTGCTGGCCATGGCCTTTGAC
CGTTATGTGGCCATCTGCCACCCACTGCGCCATGCTGCAGTGCTCAACAATACAGTAACA
GCCCAGATTGGCATCGTGGCTGTGGTCCGCGGATCCCTCTTTTTTTTCCCACTGCCTCTG
CTGATCAAGCGGCTGGCCTTCTGCCACTCCAATGTCCTCTCGCACTCCTATTGTGTCCAC
CAGGATGTAATGAAGTTGGCCTATGCAGACACTTTGCCCAATGTGGTATATGGTCTTACT
GCCATTCTGCTGGTCATGGGCGTGGACGTAATGTTCATCTCCTTGTCCTATTTTCTGATA
ATACGAACGGTTCTGCAACTGCCTTCCAAGTCAGAGCGGGCCAAGGCCTTTGGAACCTGT
GTGTCACACATTGGTGTGGTACTCGCCTTCTATGTGCCACTTATTGGCCTCTCAGTTGTA
CACCGCTTTGGAAACAGCCTTCATCCCATTGTGCGTGTTGTCATGGGTGACATCTACCTG
CTGCTGCCTCCTGTCATCAATCCCATCATCTATGGTGCCAAAACCAAACAGATCAGAACA
CGGGTGCTGGCTATGTTCAAGATCAGCTGTGACAAGGACTTGCAGGCTGTGGGAGGCAAG
TGA
Restriction Sites NotI-NotI
ACCN NM_030774
Insert Size 2800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation no
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_030774.2, NP_110401.1
RefSeq Size 2799 bp
RefSeq ORF 963 bp
Locus ID 81285
UniProt ID Q9H255
Cytogenetics 11p15.4
Domains 7tm_1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Olfactory transduction
Summary Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:PSGR (OR51E2) (NM_030774) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204752 OR51E2 (Myc-DDK-tagged)-Human olfactory receptor, family 51, subfamily E, member 2 (OR51E2) 10 ug
$300.00
RC204752L1 Lenti ORF clone of Human olfactory receptor, family 51, subfamily E, member 2 (OR51E2), Myc-DDK-tagged 10 ug
$600.00
RC204752L2 Lenti ORF clone of Human olfactory receptor, family 51, subfamily E, member 2 (OR51E2), mGFP tagged 10 ug
$600.00
RC204752L3 Lenti ORF clone of Human olfactory receptor, family 51, subfamily E, member 2 (OR51E2), Myc-DDK-tagged 10 ug
$600.00
RC204752L4 Lenti ORF clone of Human olfactory receptor, family 51, subfamily E, member 2 (OR51E2), mGFP tagged 10 ug
$600.00
RG204752 OR51E2 (tGFP-tagged) - Human olfactory receptor, family 51, subfamily E, member 2 (OR51E2) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.