FGFR1 (NM_023106) Human Untagged Clone

CAT#: SC109228

FGFR1 (untagged)-Human fibroblast growth factor receptor 1 (FGFR1), transcript variant 4

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FGFR1 (NM_023106) Human Untagged Clone
Symbol FGFR1
Synonyms bFGF-R-1; BFGFR; CD331; CEK; ECCL; FGFBR; FGFR-1; FLG; FLT-2; FLT2; HBGFR; HH2; HRTFDS; KAL2; N-SAM;
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_023106 edited
ATGTGGAGCTGGAAGTGCCTCCTCTTCTGGGCTGTGCTGGTCACAGCCACACTCTGCACC
GCTAGGCCGTCCCCGACCTTGCCTGAACAAGATGCTCTCCCCTCCTCGGAGGATGATGAT
GATGATGATGACTCCTCTTCAGAGGAGAAAGAAACAGATAACACCAAACCAAACCCCGTA
GCTCCATATTGGACATCCCCAGAAAAGATGGAAAAGAAATTGCATGCAGTGCCGGCTGCC
AAGACAGTGAAGTTCAAATGCCCTTCCAGTGGGACCCCAAACCCCACACTGCGCTGGTTG
AAAAATGGCAAAGAATTCAAACCTGACCACAGAATTGGAGGCTACAAGGTCCGTTATGCC
ACCTGGAGCATCATAATGGACTCTGTGGTGCCCTCTGACAAGGGCAACTACACCTGCATT
GTGGAGAATGAGTACGGCAGCATCAACCACACATACCAGCTGGATGTCGTGGAGCGGTCC
CCTCACCGGCCCATCCTGCAAGCAGGGTTGCCCGCCAACAAAACAGTGGCCCTGGGTAGC
AACGTGGAGTTCATGTGTAAGGTGTACAGTGACCCGCAGCCGCACATCCAGTGGCTAAAG
CACATCGAGGTGAATGGGAGCAAGATTGGCCCAGACAACCTGCCTTATGTCCAGATCTTG
AAGACTGCTGGAGTTAATACCACCGACAAAGAGATGGAGGTGCTTCACTTAAGAAATGTC
TCCTTTGAGGACGCAGGGGAGTATACGTGCTTGGCGGGTAACTCTATCGGACTCTCCCAT
CACTCTGCATGGTTGACCGTTCTGGAAGCCCTGGAAGAGAGGCCGGCAGTGATGACCTCG
CCCCTGTACCTGGAGATCATCATCTATTGCACAGGGGCCTTCCTCATCTCCTGCATGGTG
GGGTCGGTCATCGTCTACAAGATGAAGAGTGGTACCAAGAAGAGTGACTTCCACAGCCAG
ATGGCTGTGCACAAGCTGGCCAAGAGCATCCCTCTGCGCAGACAGGTAACAGTGTCTGCT
GACTCCAGTGCATCCATGAACTCTGGGGTTCTTCTGGTTCGGCCATCACGGCTCTCCTCC
AGTGGGACTCCCATGCTAGCAGGGGTCTCTGAGTATGAGCTTCCCGAAGACCCTCGCTGG
GAGCTGCCTCGGGACAGACTGGTCTTAGGCAAACCCCTGGGAGAGGGCTGCTTTGGGCAG
GTGGTGTTGGCAGAGGCTATCGGGCTGGACAAGGACAAACCCAACCGTGTGACCAAAGTG
GCTGTGAAGATGTTGAAGTCGGACGCAACAGAGAAAGACTTGTCAGACCTGATCTCAGAA
ATGGAGATGATGAAGATGATCGGGAAGCATAAGAATATCATCAACCTGCTGGGGGCCTGC
ACGCAGGATGGTCCCTTGTATGTCATCGTGGAGTATGCCTCCAAGGGCAACCTGCGGGAG
TACCTGCAGGCCCGGAGGCCCCCAGGGCTGGAATACTGCTACAACCCCAGCCACAACCCA
GAGGAGCAGCTCTCCTCCAAGGACCTGGTGTCCTGCGCCTACCAGGTGGCCCGAGGCATG
GAGTATCTGGCCTCCAAGAAGTGCATACACCGAGACCTGGCAGCCAGGAATGTCCTGGTG
ACAGAGGACAATGTGATGAAGATAGCAGACTTTGGCCTCGCACGGGACATTCACCACATC
GACTACTATAAAAAGACAACCAACGGCCGACTGCCTGTGAAGTGGATGGCACCCGAGGCA
TTATTTGACCGGATCTACACCCACCAGAGTGATGTGTGGTCTTTCGGGGTGCTCCTGTGG
GAGATCTTCACTCTGGGCGGCTCCCCATACCCCGGTGTGCCTGTGGAGGAACTTTTCAAG
CTGCTGAAGGAGGGTCACCGCATGGACAAGCCCAGTAACTGCACCAACGAGCTGTACATG
ATGATGCGGGACTGCTGGCATGCAGTGCCCTCACAGAGACCCACCTTCAAGCAGCTGGTG
GAAGACCTGGACCGCATCGTGGCCTTGACCTCCAACCAGGAGTACCTGGACCTGTCCATG
CCCCTGGACCAGTACTCCCCCAGCTTTCCCGACACCCGGAGCTCTACGTGCTCCTCAGGG
GAGGATTCCGTCTTCTCTCATGAGCCGCTGCCCGAGGAGCCCTGCCTGCCCCGACACCCA
GCCCAGCTTGCCAATGGCGGACTCAAACGCCGCTGACTGCCACCCACACGCCCTCCCCAG
ACTCCACCGTCAGCTGTAACCCTCACCCACAGCCCCTGCTGGGCCCACCACCTGTCCGTC
CCTGTCCCCTTTCCTGCTGGCAGGAGCCGGCTGCCTACCAGGGGCCTTCCTGTGTGGCCT
GCCTTCACCCCACTCAGCTCACCTCTCCCTCCACCTCCTCTCCACCTGCTGGTGAGAGGT
GCAAAGAGGCAGATCTTTGCTGCCAGCCACTTCATCCCCTCCCAGATGTTGGACCAACAC
CCCTCCCTGCCACCAGGCACTGCCTGGAGGGCAGGGAGTGGGAGCCAATGAACAGGCATG
CAAGTGAGAGCTTCCTGAGCTTTCTCCTGTCGGTTTGGTCTGTTTTGCCTTCACCCATAA
GCCCCTCGCACTCTGGTGGCAGGTGCCTTGTCCTCAGGGCTACAGCAGTAGGGAGGTCAG
TGCTTCGTGCCTCGATTGAAGGTGACCTCTGCCCCAGATAGGTGGTGCCAGTGGCTTATT
AATTCCGATACTAGTTTGCTTTGCTGACCAAATGCCTGGTACCAGAGGATGGTGAGGCGA
AGGCCAGGTTGGGGGCAGTGTTGTGGCCCTGGGGCCCAGCCCCAAACTGGGGGCTCTGTA
TATAGCTATGAAGAAAACACAAAGTGTATAAATCTGAGTATATATTTACATGTCTTTTTA
AAAGGGTCGTTACCAGAGATTTACCCATCGGGTAAGATGCTCCTGGTGGCTGGGAGGCAT
CAGTTGCTATATATTAAAACCAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_023106 unedited
NGGTTCACATTTTGTNATACGACTCACTATAGGGCGGCCGCGNAATTCGCACGAGGGAGC
TCTTGCGACCCCGCCAGNACCCGAACAGAGCCCGGGGGCGGCGGGCCGGAGCCGGGGACG
CGGGCACACGCCCGCTCGCACAAGCCACGGCGGACTCTCCCGAGGCGGAACCTCCACGCC
GAGCGAGGGTCAGTTTGAAAAGGAGGATCGAGCTCACTGTGGAGTATCCATGGAGATGTG
GAGCCTTGTCACCAACCTCTAACTGCAGAACTGGGATGTGGAGCTGGAAGTGCCTCCTCT
TCTGGGCTGTGCTGGTCACAGCCACACTCTGCACCGCTAGGCCGTCCCCGACCTTGCCTG
AACAAGATGCTCTCCCCTCCTCGGAGGATGATGATGATGATGATGACTCCTCTTCAGAGG
AGAAAGAAACAGATAACACCAAACCAAACCCCGTAGCTCCATATTGGACATCCCCAGAAA
AGATGGAAAAGAAATTGCATGCAGTGCCGGCTGCCAAGACAGTGAAGTTCAAATGCCCTT
CCAGTGGGACCCCAAACCCCACACTGCGCTGGTTGAAAAATGGCAAAGAATTCAAACCTG
ACCACAGAATTGGAGGCTACAAGGTCCGTTATGCCACCTGGAGCATCATAATGGACTCTG
TGGTGCCCTCTGACAAGGGCAACTACACCTGCATTGTGGAGAATGAGTACGGCAGCATCA
ACCACACATACCAGCTGGATGTCGTGGAGCGGTCCCCTCACCGGCCCATCCTGNCAGCAG
GGTTGCCCGCCAACAAACAGTGGCCCTGGGTAGCAACGTGGAGTTCATGTGTAAGGTGTA
CAGTGACCCGCAGCCGCACATCCAGTGGCTAAAGCCATCGAGGTGAATGGGGAGCAGATG
GCCCANACACCTGCNCTATGTCCAGATCTTGAGACTGCTGGNAGTAATACCACGACAAGA
G
3' Read Nucleotide Sequence
>OriGene 3' read for NM_023106 unedited
TATGGAACGGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTGGTTTTAATAT
ATAGCAACTGATGCCTCCCAGCCACCAGGAGCATCTTACCCGATGGGTAAATCTCTGGTA
ACGACCCTTTTAAAAAGACATGTAAATATATACTCAGATTTATACACTTTGTGTTTTCTT
CATAGCTATATACAGAGCCCCCAGTTTGGGGCTGGGCCCCAGGGCCACAACACTGCCCCC
AACCTGGCCTTCGCCTCACCATCCTCTGGTACCAGGCATTTGGTCAGCAAAGCAAACTAG
TATCGGAATTAATAAGCCACTGGCACCACCTATCTGGGGCAGAGGTCACCTTCAATCGAG
GCACGAAGCACTGACCTCCCTACTGCTGTAGCCCTGAGGACAAGGCACCTGCCACCAGAG
TGCGAGGGGCTTATGGGTGAAGGCAAAACAGACCAAACCGACAGGAGAAAGCTCAGGAAG
CTCTCACTTGCATGCCTGTTCATTGGCTCCCACTCCCTGCCCTCCAGGCAGTGCCTGGTG
GCAGGGAGGGGTGTTGGTCCAACATCTGGGAGGGGATGAAGTGGCTGGCAGCAAAGATCT
GCCTCTTTGCACCTCTCACCANCANGTGGAGAGGAGGTGGAGGGAGAGGTGAGCTGAGTG
GGGTGAAGGCAGGCCACACAGGAAGGCCCCTGGTANGCAGCCGGCTCCTGCCAGCAGGAA
AGGGGACAGGGACGGACAGGTGGTGGGCCCANCAGGNGCTGTGGGTGAGGGTTACAGCTG
ACCGTGNANTCCTGNGAGGGCGTGTGGGTGGCAATCACCGGCGTTTGAGTCCGCCATTGG
CAAGCTGGGCTGGGTGTCNGGGGCAGCAGGNCTCCTCGGNCANNCGCTCATGAGAGAAGA
CGAATCCTTCCCCTGAGACACGTANAGCTCCGGNTGTCGGAAAAGCTGGGGAGTACTGGT
CCAGGGCATGGACAAGGTCAGTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_023106
ORF Size 2196 bp
Insert Size 3000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_023106.1, NP_075594
RefSeq Size 3786
Locus ID 2260
Cytogenetics 8p11.23
Protein Families Protein Kinase, Transmembrane, Druggable Genome
Protein Pathways MAPK signaling pathway, Adherens junction, Regulation of actin cytoskeleton, Pathways in cancer, Prostate cancer, Melanoma
Gene Summary The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (4) lacks an alternate in-frame exon and uses a different in-frame splice junction compared to variant 1. This variant encodes isoform 4, also known as isoform I, H3, and the 2-Ig Domain form, which is 91 aa shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations