BMPR2 (NM_001204) Human Untagged Clone

CAT#: SC108987

BMPR2 (untagged)-Human bone morphogenetic protein receptor, type II (serine/threonine kinase) (BMPR2)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BMPR2 (NM_001204) Human Untagged Clone
Symbol BMPR2
Synonyms BMPR-II; BMPR3; BMR2; BRK-3; POVD1; PPH1; T-ALK
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001204 edited
ATGACTTCCTCGCTGCAGCGGCCCTGGCGGGTGCCCTGGCTACCATGGACCATCCTGCTG
GTCAGCGCTGCGGCTGCTTCGCAGAATCAAGAACGGCTATGTGCGTTTAAAGATCCGTAT
CAGCAAGACCTTGGGATAGGTGAGAGTAGAATCTCTCATGAAAATGGGACAATATTATGC
TCGAAAGGTAGCACCTGCTATGGCCTTTGGGAGAAATCAAAAGGGGACATAAATCTTGTA
AAACAAGGATGTTGGTCTCACATTGGAGATCCCCAAGAGTGTCACTATGAAGAATGTGTA
GTAACTACCACTCCTCCCTCAATTCAGAATGGAACATACCGTTTCTGCTGTTGTAGCACA
GATTTATGTAATGTCAACTTTACTGAGAATTTTCCACCTCCTGACACAACACCACTCAGT
CCACCTCATTCATTTAACCGAGATGAGACAATAATCATTGCTTTGGCATCAGTCTCTGTA
TTAGCTGTTTTGATAGTTGCCTTATGCTTTGGATACAGAATGTTGACAGGAGACCGTAAA
CAAGGTCTTCACAGTATGAACATGATGGAGGCAGCAGCATCCGAACCCTCTCTTGATCTA
GATAATCTGAAACTGTTGGAGCTGATTGGCCGAGGTCGATATGGAGCAGTATATAAAGGC
TCCTTGGATGAGCGTCCAGTTGCTGTAAAAGTGTTTTCCTTTGCAAACCGTCAGAATTTT
ATCAACGAAAAGAACATTTACAGAGTGCCTTTGATGGAACATGACAACATTGCCCGCTTT
ATAGTTGGAGATGAGAGAGTCACTGCAGATGGACGCATGGAATATTTGCTTGTGATGGAG
TACTATCCCAATGGATCTTTATGCAAGTATTTAAGTCTCCACACAAGTGACTGGGTAAGC
TCTTGCCGTCTTGCTCATTCTGTTACTAGAGGACTGGCTTATCTTCACACAGAATTACCA
CGAGGAGATCATTATAAACCTGCAATTTCCCATCGAGATTTAAACAGCAGAAATGTCCTA
GTGAAAAATGATGGAACCTGTGTTATTAGTGACTTTGGACTGTCCATGAGGCTGACTGGA
AATAGACTGGTGCGCCCAGGGGAGGAAGATAATGCAGCCATAAGCGAGGTTGGCACTATC
AGATATATGGCACCAGAAGTGCTAGAAGGAGCTGTGAACTTGAGGGACTGTGAATCAGCT
TTGAAACAAGTAGACATGTATGCTCTTGGACTAATCTATTGGGAGATATTTATGAGATGT
ACAGACCTCTTCCCAGGGGAATCCGTACCAGAGTACCAGATGGCTTTTCAGACAGAGGTT
GGAAACCATCCCACTTTTGAGGATATGCAGGTTCTCGTGTCTAGGGAAAAACAGAGACCC
AAGTTCCCAGAAGCCTGGAAAGAAAATAGCCTGGCAGTGAGGTCACTCAAGGAGACAATC
GAAGACTGTTGGGACCAGGATGCAGAGGCTCGGCTTACTGCACAGTGTGCTGAGGAAAGG
ATGGCTGAACTTATGATGATTTGGGAAAGAAACAAATCTGTGAGCCCAACAGTCAATCCA
ATGTCTACTGCTATGCAGAATGAACGCAACCTGTCACATAATAGGCGTGTGCCAAAAATT
GGTCCTTATCCAGATTATTCTTCCTCCTCATACATTGAAGACTCTATCCATCATACTGAC
AGCATCGTGAAGAATATTTCCTCTGAGCATTCTATGTCCAGCACACCTTTGACTATAGGG
GAAAAAAACCGAAATTCAATTAACTATGAACGACAGCAAGCACAAGCTCGAATCCCCAGC
CCTGAAACAAGTGTCACCAGCCTCTCCACCAACACAACAACCACAAACACCACAGGACTC
ACGCCAAGTACTGGCATGACTACTATATCTGAGATGCCATACCCAGATGAAACAAATCTG
CATACCACAAATGTTGCACAGTCAATTGGGCCAACCCCTGTCTGCTTACAGCTGACAGAA
GAAGACTTGGAAACCAACAAGCTAGACCCAAAAGAAGTTGATAAGAACCTCAAGGAAAGC
TCTGATGAGAATCTCATGGAGCACTCTCTTAAACAGTTCAGTGGCCCAGACCCACTGAGC
AGTACTAGTTCTAGCTTGCTTTACCCACTCATAAAACTTGCAGTAGAAGCAACTGGACAG
CAGGACTTCACACAGACTGCAAATGGCCAAGCATGTTTGATTCCTGATGTTCTGCCTACT
CAGATCTATCCTCTCCCCAAGCAGCAGAACCTTCCCAAGAGACCTACTAGTTTGCCTTTG
AACACCAAAAATTCAACAAAAGAGCCCCGGCTAAAATTTGGCAGCAAGCACAAATCAAAC
TTGAAACAAGTCGAAACTGGAGTTGCCAAGATGAATACAATCAATGCAGCAGAACCTCAT
GTGGTGACAGTCACCATGAATGGTGTGGCAGGTAGAAACCACAGTGTTAACTCCCATGCT
GCCACAACCCAATATGCCAATGGGACAGTACTATCTGGCCAAACAACCAACATAGTGACA
CATAGGGCCCAAGAAATGTTGCAGAATCAGTTTATTGGTGAGGACACCCGGCTGAATATT
AATTCCAGTCCTGATGAGCATGAGCCTTTACTGAGACGAGAGCAACAAGCTGGCCATGAT
GAAGGTGTTCTGGATCGTCTTGTGGACAGGAGGGAACGGCCACTAGAAGGTGGCCGAACT
AATTCCAATAACAACAACAGCAATCCATGTTCAGAACAAGATGTTCTTGCACAGGGTGTT
CCAAGCACAGCAGCAGATCCTGGGCCATCAAAGCCCAGAAGAGCACAGAGGCCTAATTCT
CTGGATCTTTCAGCCACAAATGTCCTGGATGGCAGCAGTATACAGATAGGTGAGTCAACA
CAAGATGGCAAATCAGGATCAGGTGAAAAGATCAAGAAACGTGTGAAAACTCCCTATTCT
CTTAAGCGGTGGCGCCCCTCCACCTGGGTCATCTCCACTGAATCGCTGGACTGTGAAGTC
AACAATAATGGCAGTAACAGGGCAGTTCATTCCAAATCCAGCACTGCTGTTTACCTTGCA
GAAGGAGGCACTGCTACAACCATGGTGTCTAAAGATATAGGAATGAACTGTCTGTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001204 unedited
CCAATTCCCTCGAGGGTGAAGGAAGTCCCGAAGCGAAACTTAAGGAATCCTGCCTTCCCG
GAGCCGCGGGCGATGCGACTAGGGCTGCCGGGCGCCGCCGCCGCCCGTCCGGCTTCGTCC
TTCCCGGCAGTCGGGAACTAGTTCTGACCCTCGCCCCCCGACCCCGGATCGATANCCTTG
CTCTCCGCACCCTGGATATGTTTTCTCCCAGACCTGGATATTTTTTTGATATCGTGAAAC
TACGAGGGAAATAATTTGGGGGATTTCTTCTTGGCTCCCTGCTTTCCCCACAGACATGCC
TTCCGTTTGGAGGGCCGCGGCACCCCGTCCGAGGCGAAGGAACCCCCCCAGCCGCGAGGG
AGAGAAATGAAGGGAATTTCTGCAGCGGCATGAAAGCTCTGCAGCTAGGTCCTCTCATCA
GCCATTTGTCCTTTCAAACTGTATTGTGATACGGGCAGGATCAGTCCACGGGAGAGAAGA
CGAGCCTCCCGGCTGTTTCTCCGCCGGTCTACTTCCCATATTTCTTTTCTTTGCCCTCCT
GATTCTTGGCTGGCCCAGGGATGACTTCCTCGCTGCAGCGGCCCTGGCGGGTGCCCTGGC
TACCATGGACCATCCTGCTGGTCAGCGCTGCGGCTGCTTCGCAGAATCAAGAACGGCTAT
GTGCGTTTAAAGATCCGTATCAGCAAGACCCTTGGATAGGTGAGAGTAGAATCTCTCATN
GAAATGGGACAATATTATGCTCGAAAGGTAGCACCTGCTATGGGCCTTGGGAGAAATCAA
AAGGGACATAAATCTTGTAAACAGGGATGTTGGTCTCACATTTGGAGATCCCAAGAGTGT
CCCTTTGAAAATGTGTAGTAACTACCCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001204 unedited
NTCCCCCCCCCCGGTCCNCCGCCGCCCCCCTCCCCCNCCNNTCCTCCGCCTCTGCTCCGC
GGCCCGGCATCTAGCATCGAGTTTTTTTTTTTTTTTTTTAAACATCTTCTGCATGTTTAA
ATGATGCAAAAAAAATTTCACTCCATAGGCTTGAAAACATTTCACAGACAGTTCATTCCT
ATATCTTTAGACACCATGGTTGTAGCAGTGCCTCCTTCTGCAAGGTAAACAGCAGCGCTG
GATTTGGAATGAACTGCCCTGTTACTGCCATTATTGTTGACTTCACAGTCCAGCGATTCA
GTGGAGATGACCCAGGTGGAGGGGCGCCACCGCTTAAGAGAATAGGGAGTTTTCACACGT
TTCTTGATCTTTTCACCTGATCCTGATTTGCCATCTTGTGTTGACTCACCTATCTGTATA
CTGCTGCCATCCAGGACATTTGTGGCTGAAAGATCCAGAGAATTAGGCCTCTGTGCTCTT
CTGGGCTTTGATGGCCCAGGATCTGCTGCTGTGCTTGGAACACCCTGTGCAAGAACATCT
TGCCCTGAACATGGATTGCTGTTGTTGTTATTGGAATTAGTTCGGCCACCTTCTAGTTGG
CCGCTCCCTCCTGTCCACAAGACGATCCAGAACACCTTCATCATGGCCAGNTTGNTGCTC
TCGTCTCAGTAAAGGCTCATGCTCATCAGGACTGTGATTCATACTCACCCCGTGTGTCCT
TACCAATAAACTGATTCTCGAACATTTCTTGGCCCTTATGTGTCACTATGTTCGGTGCTT
GGCCAGACACTACCGGCCCATTGCACATTGGGTTCGGGCCCATGGCACTTACCACTGTGG
CTTCTACCTGCCACACCATCCTGGGGACTGCCACACAAGAGGCTTTGTGCATTGATTGGT
TTTATTTGGGCACCTCAGTTCCACTTGTTTAAGGTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001204
ORF Size 3117 bp
Insert Size 3670
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001204.5, NP_001195
RefSeq Size 11449
RefSeq ORF 3117
Locus ID 659
Cytogenetics 2q33.1-q33.2
Domains Activin_recp, pkinase, TyrKc, S_TKc
Protein Families Protein Kinase, Transmembrane, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, TGF-beta signaling pathway
Gene Summary This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are BMPs, which are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the full length isoform. Isoform 1 is 508 aa longer than isoform 2 and includes a long cytoplasmic tail unique to this bone morphogenetic protein type II receptor.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations