BAD (NM_004322) Human Untagged Clone

CAT#: SC107955

BAD (untagged)-Human BCL2-associated agonist of cell death (BAD), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BAD (NM_004322) Human Untagged Clone
Symbol BAD
Synonyms BBC2; BCL2L8
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_004322 edited
ATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAGGAAGACTCCAGCTCTGCAGAGAGG
GGCCTGGGCCCCAGCCCCGCAGGGGACGGGCCCTCAGGCTCCGGCAAGCATCATCGCCAG
GCCCCAGGCCTCCTGTGGGACGCCAGTCACCAGCAGGAGCAGCCAACCAGCAGCAGCCAT
CATGGAGGCGCTGGGGCTGTGGAGATCCGGAGTCGCCACAGCTCCTACCCCGCGGGGACG
GAGGACGACGAAGGGATGGGGGAGGAGCCCAGCCCCTTTCGGGGCCGCTCGCGCTCGGCG
CCCCCCAACCTCTGGGCAGCACAGCGCTATGGCCGCGAGCTCCGGAGGATGAGTGACGAG
TTTGTGGACTCCTTTAAGAAGGGACTTCCTCGCCCGAAGAGCGCGGGCACAGCAACGCAG
ATGCGGCAAAGCTCCAGCTGGACGCGAGTCTTCCAGTCCTGGTGGGATCGGAACTTGGGC
AGGGGAAGCTCCGCCCCCTCCCAGTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004322 unedited
NTTTCACGATTTGTATACGATTCATATAGGCGGCCGCGNAATTCGCACGAGGGGGAGGCG
GCAGGCCCGGGTCAGGGGCCTCGAGATCGGGCTTGGGCCCAGAGCATGTTCCAGATCCCA
GAGTTTGAGCCGAGTGAGCAGGAAGACTCCAGCTCTGCAGAGAGGGGCCTGGGCCCCAGC
CCCGCAGGGGACGGGCCCTCAGGCTCCGGCAAGCATCATCGCCAGGCCCCAGGCCTCCTG
TGGGACGCCAGTCACCAGCAGGAGCAGCCAACCAGCAGCAGCCATCATGGAGGCGCTGGG
GCTGTGGAGATCCGGAGTCGCCACAGCTCCTACCCCGCGGGGACGGAGGACGACGAAGGG
ATGGGGGAGGAGCCCAGCCCCTTTCGGGGCCGCTCGCGCTCGGCGCCCCCCAACCTCTGG
GCAGCACAGCGCTATGGCCGCGAGCTCCGGAGGATGAGTGACGAGTTTGTGGACTCCTTT
AAGAAGGGACTTCCTCGCCCGAAGAGCGCGGGCACAGCAACGCAGATGCGGCAAAGCTCC
AGCTGGACGCGAGTCTTCCAGTCCTGGTGGGATCGGAACTTGGGCAGGGGAAGCTCCGCC
CCCTCCCAGTGACCTTCGCTCCACATCCCGAAACTCCACCCGTTCCCACTGCCCTGGGCA
GCCATCTTGAATATGGGCGGAAGTACTTCCCTCAGGCCTATGCAAAAAGAGGATCCGTGC
TGTCTCCTTTGGAGGGAGGGCTGACCCAGATTCCCTTCCCGTGCGTGTGAAGCCCCCGGA
AGCTTGGTCCCATCCGAAGTTATGGGTTTTCCGCCCCCAGCCGCCGGTAGTGGCTCCGTG
GCCCCGCCCTCAGCTTCCGGCTTTCCCCCAGCGCCTGCCCTAATTGCGAGCCAGGTTTAC
CGTTGTGTACCGGGG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004322 unedited
GCCCTCGATAGTCGAGTTTTTTTTTTTTTTTTTTTTGCACAAACGCGGTCTTTATTAACA
TTTGGTAGTGAGCACGGCCCCCAGGGCATCGCGGGGGCTCGGGTCCCGGTGACGCAACGG
TTAAACCTGGCTCGCGACTTAACGCAGGCGCCTGGGGGAAAGCCCGGAGCCTGAGGGCGG
GGCCACGGAGCCACTTCCGGCGGCTGTGGGCGGAAAACCCAAAACTTCCGATGGGACCAA
GCCTTCCGTGGCTTCACACGCACCGGAAGGGAATCTGGGTCAGCCCTCCCTCCAAAGGAG
ACAGCACGGATCCTCTTTTTGCATAGGCCTGAGGGAAGTACTTCCGCCCATATTCAAGAT
GGCTGCCCAGGGCAGTGGGAACGGGTGGAGTTTCGGGATGTGGAGCGAAGGTCACTGGGA
GGGGGCGGAGCTTCCCCTGCCCAAGTTCCGATCCCACCAGGACTGGAAGACTCGCGTCCA
GCTGGAGCTTTGCCGCATCTGCGTTGCTGTGCCCGCGCTCTTCGGGCGAGGAAGTNCCTT
CTTAAAGGAGTCCACAAACTCGTCACTCATCCTCCGGAGCTCGCGGCCATAGCGCTGTGC
TGCCCANAGTTGGGGGGCGCCNAGCGCGAGCGGCCCCNAAAGGGGCTGGGCTCCTCCCCA
TCCCTTTGTCGTCCTCCGTCCCCGCGGGGTATGAGCTGTGGCGACTTCCGATCTCACAGC
CCCAGCGCCTCATGATGGCTGCTGCTGGNTGGCTGCTCCTGCTGGTGACTGGCGTCCACA
CGAAGCCTGNGGCCCTGCGATGATTCTTGCCGAAACCTGAGGCCCCTGTCCCTGTCGGGC
TGGGGCCCAAGCCCCCTCTTGCAAGCTGAATCTTCTGCTACTCGCTCAACTTTGGGACTG
AACATGTCTGGGCCAACCCGATTTGAGGCCTGAACGGNCTGCCCCTCCCTTTGCAGAATC
GGGCCCCCTTAAGAGTGTTACAAATTGAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004322
ORF Size 507 bp
Insert Size 1110
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004322.2, NP_004313
RefSeq Size 1127
RefSeq ORF 507
Locus ID 572
Cytogenetics 11q13.1
Protein Families Druggable Genome
Protein Pathways ErbB signaling pathway, Apoptosis, VEGF signaling pathway, Focal adhesion, Neurotrophin signaling pathway, Insulin signaling pathway, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Pathways in cancer, Colorectal cancer, Pancreatic cancer, Endometrial cancer, Prostate cancer, Melanoma, Chronic myeloid leukemia, Acute myeloid leukemia, Non-small cell lung cancer
Gene Summary The protein encoded by this gene is a member of the BCL-2 family. BCL-2 family members are known to be regulators of programmed cell death. This protein positively regulates cell apoptosis by forming heterodimers with BCL-xL and BCL-2, and reversing their death repressor activity. Proapoptotic activity of this protein is regulated through its phosphorylation. Protein kinases AKT and MAP kinase, as well as protein phosphatase calcineurin were found to be involved in the regulation of this protein. Alternative splicing of this gene results in two transcript variants which encode the same isoform. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations