DFFB (NM_004402) Human Untagged Clone

CAT#: SC107911

DFFB (untagged)-Human DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) (DFFB)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name DFFB (NM_004402) Human Untagged Clone
Symbol DFFB
Synonyms CAD; CPAN; DFF-40; DFF2; DFF40
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC107911 sequence for NM_004402 edited (data generated by NextGen Sequencing)
ATGCTCCAGAAGCCCAAGAGCGTGAAGCTGCGGGCCCTGCGCAGCCCGAGGAAGTTCGGC
GTGGCTGGCCGGAGCTGCCAGGAGGTGCTGCGCAAGGGCTGTCTCCGCTTCCAGCTCCCT
GAGCGCGGTTCCCGGCTGTGCCTGTACGAGGATGGCACGGAGCTGACGGAAGATTACTTC
CCCAGTGTTCCCGACAACGCCGAGCTGGTGCTGCTCACCTTGGGCCAGGCCTGGCAGGGC
TATGTGAGCGACATCAGGCGCTTCCTCAGTGCATTTCACGAGCCACAGGTGGGGCTCATC
CAGGCCGCCCAGCAGCTGCTGTGTGATGAGCAGGCCCCACAGAGGCAGAGGCTGCTGGCT
GACCTCCTGCACAACGTCAGCCAGAACATCGCGGCCGAGACCCGGGCTGAGGACCCGCCG
TGGTTTGAAGGCTTGGAGTCCCGATTTCAGAGCAAGTCTGGCTATCTGAGATACAGCTGT
GAGAGCCGGATCCGGAGTTACCTGAGGGAGGTGAGCTCCTACCCCTCCACGGTGGGTGCG
GAGGCTCAGGAGGAATTCCTGCGGGTCCTCGGCTCCATGTGCCAGAAGCTCCGGTCCATG
CAGTACAATGGCAGCTACTTCGACAGAGGAGCCAAGGGCGGCAGCCGCCTCTGCACACCG
GAAGGCTGGTTCTCCTGCCAGGGTCCCTTTGACATGGACAGCTGCTTATCAAGACACTCC
ATCAACCCCTACAGTAACAGGGAGAGCAGGATCCTCTTCAGCACCTGGAACCTGGATCGC
ATAATAGAAAAGAAACGCACCATCATTCCTACACTGGTGGAAGCAATTAAGGAACAAGAT
GGAAGAGAAGTGGACTGGGAGTATTTTTATGGCCTGCTTTTTACCTCAGAGAACCTAAAA
CTAGTGCACATTGTCTGCCATAAGAAAACCACCCACAAGCTCAACTGTGACCCAAGCAGA
ATCTACAAACCCCAGACAAGGTTGAAGCGGAAGCAGCCTGTGCGGAAACGCCAGTGA

Clone variation with respect to NM_004402.2
587 g=>a;779 a=>g
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004402 unedited
AAAAAAAGGGGANNNANAANNAAAAACACCCCCCCGGTTCACAATTGTATACGACTCATA
TAGGCGGCCGCGNAATTCGCACGAGGCCAGCTTGCAGAGCTCACCAGGTGCAGACCCCTG
CGGCCAGGGCGAGGACGGATCTGAGCAGCTGGGCAGCAGGTGCCACCGCCTGTGGGACCC
AGAGGGCTTGAGGACATCTGCAATGCTCCAGAAGCCCAAGAGCGTGAAGCTGCGGGCCCT
GCGCAGCCCGAGGAAGTTCGGCGTGGCTGGCCGGAGCTGCCAGGAGGTGCTGCGCAAGGG
CTGTCTCCGCTTCCAGCTCCCTGAGCGCGGTTCCCGGCTGTGCCTGTACGAGGATGGCAC
GGAGCTGACGGAAGATTACTTCCCCAGTGTTCCCGACAACGCCGAGCTGGTGCTGCTCAC
CTTGGGCCAGGCCTGGCAGGGCTATGTGAGCGACATCAGGCGCTTCCTCAGTGCATTTCA
CGAGCCACAGGTGGGGCTCATCCAGGCCGCCCAGCAGCTGCTGTGTGATGAGCAGGCCCC
ACAGAGGCAGAGGCTGCTGGCTGACCTCCTGCACAACGTCAGCCAGAACATCGCGGCCGA
GACCCGGGCTGAGGACCCGCCGTGGTTTGAAGGCTTGGAGTCCCGATTTCAGAGCAAGTC
TGGCTATCTGAGATACAGCTGTGAGAGCCCNATCCGGAGTTACCTGNAGGAGGTGAGCTC
CTACCCCTCCCACGTGGGTGCGGAGGCTCCAGAGGAATTCCTGCCGCTCCTCCGCTCCAT
GGGCCANAAGCTTCCGTCCATGCAGTACAATGGCAGCTACTTCCACAGAGGAGCCAAGGC
CGGCAGCCGCCTTTGCACACCGGAAGGGCTGTTCTCCCTGCCGGGTCCCTTTGACAGGAA
CAGCTGCTTAAN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004402 unedited
NNTTTCTGTGNACCGCGCCGCAATCTANGATCGAGTTTTTTTTTTTTTTTTTTTTATTTT
TGAAAAATCTTTATTGCTTTTCCTGATTGTACAACAAATGTAAAAATTCAAATATTACAA
AATGACTTAATTTAAAAAGTACATTTTAACATGTTATAAAATAAATGCCCATTTCAAAAA
ATTCAAGTATCATAAAATACATGACGTAGAAAATGAGTCCTCTGTAATCTAGCCCAACCC
CCGTATCCCCCAGGATTACTGCTGTTCAGATCCGCGTGTTTCCTTCCAGACCGTCTCGTG
GTGNCNNNNNACCCNCCCGGNCCNCCCAACCCCCCCAACCAACGGGGCCTTGGACCATGA
AGCCTTCCATATTGAATCCCGNAGNATGAAATAGTTAACCGCTGAACCCAACGGAAGCCA
AGGGTTTCAANCTGCCCGGATGCCCCCTGGAAACAAGCTTCCCAGTTTTCCTTAACACCA
GAAAACCCCTTTTTCCCTTCAATAAAAAAACCCTTGGAAAAACCTGGGGGAACACCAAAT
TTTTTTGGCCCCTTTTGGTAAAATGGTATTCAAGGGTTGGAAATCCCTTGAAAAATAAAA
TGGGATACCCCTTAACCCATTTTTTTTGGGCCCCTTAAAAAAAAAAAACAAGAGTTTTCC
CCCGGGGGTTCAAAACGGGGAAAAAAACTTTGGTTTTCAAAAAAAAAACAATTTGGGGGG
GGGGGGGTTTTCCCCCTTTTTTTTCTCTGTGGCCCCTTTTTTTAATAAAACAAATTTTTC
AACCCGGGGGGGTCACGAGGGGGCCCCCACGGGGGGGGTTTTAAAAGCCCCCCCGGTGAT
AAACCCCCCCCCACCACCCTC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004402
ORF Size 1017 bp
Insert Size 3340
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004402.2, NP_004393
RefSeq Size 3034
Locus ID 1677
Cytogenetics 1p36.32
Domains CAD
Protein Families Druggable Genome
Protein Pathways Apoptosis
Gene Summary Nuclease that induces DNA fragmentation and chromatin condensation during apoptosis. Degrades naked DNA and induces apoptotic morphology. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains two consecutive alternate splice junctions compared to variant 1. The resulting isoform (2) has the same N- and C-termini but lacks an internal segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations