LRATD2 (NM_174911) Human Untagged Clone

SKU
SC106977
FAM84B (untagged)-Human family with sequence similarity 84, member B (FAM84B)
$450.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LRATD2
Synonyms BCMP101; FAM84B; NSE2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC106977 sequence for NM_174911 edited (data generated by NextGen Sequencing)
ATGGGCAACCAGGTGGAGAAATTGACCCACCTAAGTTACAAGGAAGTTCCCACGGCCGAC
CCGACTGGCGTGGACCGGGACGACGGGCCCCGCATTGGGGTCTCCTACATTTTCTCCAAT
GACGATGAGGACGTGGAGCCGCAGCCGCCGCCTCAGGGGCCAGATGGCGGCGGCTTGCCC
GACGGTGGGGACGGGCCGCCGCCGCCCCAGCCGCAGCCCTACGATCCGCGGCTGCACGAG
GTGGAATGCTCCGTGTTCTACCGGGACGAATGCATCTACCAGAAGAGCTTCGCGCCGGGC
TCGGCGGCGCTGAGTACCTACACGCCCGAGAACCTGCTCAACAAGTGCAAGCCGGGCGAT
CTGGTGGAGTTCGTGTCGCAGGCTCAGTACCCGCACTGGGCCGTATATGTGGGTAACTTC
CAGGTGGTGCACCTGCACCGGCTGGAGGTGATTAACAGCTTCCTGACTGACGCCAGCCAG
GGCCGTCGCGGCCGCGTGGTCAACGATCTGTACCGCTACAAGCCGCTAAGCTCCAGCGCC
GTGGTGCGCAACGCGCTGGCGCACGTGGGTGCCAAGGAGCGCGAGCTGAGCTGGCGCAAC
TCGGAGAGTTTCGCCGCCTGGTGCCGCTACGGCAAGCGCGAGTTCAAGATCGGCGGCGAG
CTGCGCATCGGCAAGCAGCCCTACCGGCTGCAGATTCAGCTGTCGGCGCAGCGCAGCCAC
ACGCTCGAGTTCCAGAGTCTAGAGGACCTGATCATGGAGAAGCGACGCAACGACCAGATC
GGGCGCGCGGCCGTGCTGCAGGAGCTCGCCACGCACCTGCACCCGGCGGAGCCGGAGGAG
GGCGACAGCAACGTGGCGCGGACTACGCCGCCTCCCGGGCGCCCCCCTGCGCCCAGCTCC
GAGGAGGAGGACGGAGAGGCAGTGGCACACTGA

Clone variation with respect to NM_174911.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_174911 unedited
GCACGAGGGGACCTGTGCAAATGACCCTGGAGTTGGTTTCGCTTTCTCCCCTTGCGGCGG
TGTGAACGTGTGTCCGCAGCGTGATGGGCAACCAGGTGGAGAAATTGACCCACCTAAGTT
ACAAGGAAGTTCCCACGGCCGACCCGACTGGCGTGGACCGGGACGACGGGCCCCGCATTG
GGGTCTCCTACATTTTCTCCAATGACGATNAGGACGTGGAGCCGCAGCCGCCGCCT
Restriction Sites NotI-NotI
ACCN NM_174911
Insert Size 500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_174911.3, NP_777571.1
RefSeq Size 5249 bp
RefSeq ORF 933 bp
Locus ID 157638
UniProt ID Q96KN1
Cytogenetics 8q24.21
Write Your Own Review
You're reviewing:LRATD2 (NM_174911) Human Untagged Clone
Your Rating
SKU Description Size Price
RC207996 FAM84B (Myc-DDK-tagged)-Human family with sequence similarity 84, member B (FAM84B) 10 ug
$450.00
RC207996L1 Lenti ORF clone of Human family with sequence similarity 84, member B (FAM84B), Myc-DDK-tagged 10 ug
$750.00
RC207996L2 Lenti ORF clone of Human family with sequence similarity 84, member B (FAM84B), mGFP tagged 10 ug
$750.00
RC207996L3 Lenti ORF clone of Human family with sequence similarity 84, member B (FAM84B), Myc-DDK-tagged 10 ug
$750.00
RC207996L4 Lenti ORF clone of Human family with sequence similarity 84, member B (FAM84B), mGFP tagged 10 ug
$750.00
RG207996 FAM84B (tGFP-tagged) - Human family with sequence similarity 84, member B (FAM84B) 10 ug
$650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.