Citrate synthetase(CS) (XM_012179) Human Untagged Clone

CAT#: SC106723

(untagged)-Human citrate synthase (CS) mRNA

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Citrate synthetase(CS) (XM_012179) Human Untagged Clone
Symbol CS
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for XM_012179, the custom clone sequence may differ by one or more nucleotides


ATGTGGTCACCATGCTGGACAACTTTCCCACCAATCTACACCCCATGTCTCAGCTCAGTGCAGCTGTTAC
AGCCCTCAACAGTGAAAGTAACTTTGCCCAAGCATATGCACGGGGTATCAGCCGAACCCAAGTACTGGGA
GTTGATTTATGAAGACTCTGTGGATCTAATCACAAAGCTACCTTGTGTCGCAGCAAAGATCTACCGAAAT
CTCTATGGAGAAGGCAGTGGTATTGGGGCCATTGACTCTAACCTGGACTGGTCTCACAGTTTCACCAACA
TGTTAGGCTATACTGATCATCAGTTCCCTGAGCTCATGCACCTGTACCTCACTATCCACAGTGACCATGA
GGGCGGCAATGTAAGTGCCCATACCAGCCACTTGGTGGGCAGTGGCCTTTCAGACCCTTACCTGTCCTTT
GCAGCAGCCATGAACGGGCTGGCAGGGCCTCTCCATGGACTGGCAAATCAGGAAGTGCTTGTCTGGCTAA
CACAGCTGCAGAAGGAAGTTGGCAAAGATGTGTCAGATGAGAAGTTATGA


5' Read Nucleotide Sequence
>OriGene 5' read for XM_012179 unedited
TTCATATTATGTATACGACTCCTATAGGCGGCCGCGNAATCGGCACGAGGCGGCCTCTGG
TGCAGCGGCGGCGGCTCCTGTTCCTGCCGCAGCTCTCTCCCTTTCTTACCTCCCCACCAG
ATCCCGGAGATCGCCCGCCATGGCTTTACTTACTGCGGCCGCCCGGCTCTTGGGAACCAA
GAATGCATCTTGTCTTGTTCTTGCAGCCCGGCATGCCAGTGCTTCCTCCACGAATTTGAA
AGACATATTGGCTGACCTGATACCTAAGGAGCAGGCCAGAATTAAGACTTTCAGGCAGCA
ACATGGCAAGACGGTGGTGGGCCAAATCACTGTGGACATGATGTATGGTGGCATGAGAGG
CATGAAGGGATTGGTCTATGAAACATCAGTTCTTGATCCTGATGAGGGCATCCGTTTCCG
AGGCTTTAGTATCCCTGAATGCCAGAAACTGCTACCCAAGGCTAAGGGTGGGGAAGAACC
CCTGCCTGAGGGCTTATTTTTGGCTGCTGGTAACTGGACATATCCCAACAGAGGAACAGG
TATCTTGGCTCTCAAAAGAGTGGGCCAAAGAGGGCAGCTCTGCCTTCCCATGTGGTCACC
ATGCCTGGACAACTTTCCCACCAATCCTACACCCCATGTCTCAGCTCAGTGCAGCTGTTA
CAGCCCTCAACCAGCGAAAGTAACTTTGCCCCGACCTATGCCCAGGGTATTAGCCCAACC
CAGTACTGGGAGGTTGATTATGAAGACTCTATGGATCTAATCCCGCAAGCTACCTTTGTG
TTGCACCAAAAACTCACCCTAACCTTTACACAACAAGCCACCGGTTTTGGGGCCACTTGC
CTTTTAACCTGTACCGGCCTCCCCAATTTCCCAACAAGTAAGGGCTTCCCCGATCATCAC
GTCCCTGGACTTCCGCCCCCGGTCCCTTCACCTTCCCCAGGGG
3' Read Nucleotide Sequence
>OriGene 3' read for XM_012179 unedited
CCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTCATTGTTAATAAAAACATTTATT
TTGCATTTTATACAGAACAACCTGAAGTCTCCATCATGACTTGACAGTTACCCAGGGGTT
TACAGTGTGTCCAACTCAACAGTGTGGTTCTGGGACTGGGTATCCACACAAACACAGGCA
GGAGTTTGGAGGAAAGATGGGGGCACAGCAGGAGTGTATCTTAATCCTTTCTCAAAGAAA
AAGAAGTAGAGCATTCTGAGTTGCTGAAAACCTGTGCAAATGGGGCTTCTGAAACATTGT
ACTGTGAGCTCTCAGGGAAAGGGAGGAAAAAGATGTTGATAAATAAGGAGGCAATTTCTT
GAGGCAGGGGACGAGGAGGGAGGCTTACTATTTTTAATGCCCTCAGCCCCAGTACCTGAT
AATCAGAGGAGACCATGTCCAATCTTGAATCAATTCCCTGTTCAAAAAGAGGTGCTAATA
CCCCGGGGACAAGACTCTGAAAATATCATGCTGGTCATTCCGGAGTTCTATGCCCCACAG
CATATTAAAAGATGGGGGTTGGTGGGAGGGGNGGNAAGNCCANAANGCNCCCGGCTTGTT
TTTCTGTGGAAGTAAAAACCTTAATTTCACATTAAGCACTGGAAAAACCCAATGACTTGG
CCCACAGATTTGTTTGAGAGGTTTTTTTTAGGGACCAAGAGGCGCGAGGTCACAAATTCC
TCCTGCCTGGGGGCAACAGTGTGAAAAAGCTTGGAAGAGGGCATCTCTAAGCAATGGTAA
TCACAAAACTCTCGACCCTAATCTCAATTGGTATAGCGTACAAAAAATTACATTTTGGCG
CCCCATTAACAAAGCCACGCCTTCTGGCCCCTTGGGGATTAAAAAATTACAATAGCTTGT
CTATCTACCACAGTATTTGTTTAAGGGACTCTCGCTCACGTTTACCCCCCGCCTCCACTC
CCGCTTTATATCTCTCCGTGTTGCAGAGCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_012179
ORF Size 540 bp
Insert Size 2880
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 3237
RefSeq ORF 540
Locus ID 1431
Cytogenetics 12q13.3
Domains citrate_synt
Protein Pathways Citrate cycle (TCA cycle), Glyoxylate and dicarboxylate metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene is a Krebs tricarboxylic acid cycle enzyme that catalyzes the synthesis of citrate from oxaloacetate and acetyl coenzyme A. The enzyme is found in nearly all cells capable of oxidative metablism. This protein is nuclear encoded and transported into the mitochondrial matrix, where the mature form is found. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.