NOTCH1 (XM_054745) Human Untagged Clone

CAT#: SC104359

(untagged)-Human similar to Neurogenic locus notch homolog protein 1 precursor (Notch 1) (hN1) (Translocation-associated notch protein TAN-1) (LOC257478)

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NOTCH1 (XM_054745) Human Untagged Clone
Symbol NOTCH1
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for XM_054745, the custom clone sequence may differ by one or more nucleotides


ATGCCGCCGGAGCAGCTGCGCAACAGCTCCTTCCACTTCCTGCGGGAGCTCAGCCGCGTGCTGCACACCA
ACGTGGTCTTCAAGCGTGACGCACACGGCCAGCAGATGATCTTCCCCTACTACGGCCGCGAGGAGGAGCT
GCGCAAGCACCCCATCAAGCGTGCCGCCGAGGGCTGGGCCGCACCTGACGCCCTGCTGGGCCAGGTGAAG
GCCTCGCTGCTCCCTGGTGGCAGCGAGGGTGGGCGGCGGCGGAGGGAGCTGGACCCCATGGACGTCCGCG
GCTCCATCGTCTACCTGGAGATTGACAACCGGCAGTGTGTGCAGGCCTCCTCGCAGTGCTTCCAGAGTGC
CACCGACGTGGCCGCATTCCTGGGAGCGCTCGCCTCGCTGGGCAGCCTCAACATCCCCTACAAGATCGAG
GCCGTGCAGACTCAGTGCGAGTGCAGCGATTTGAAGTTGACTAATCCTCCTTCCTTAAAGGAGAAAAAAG
TAAAAGCCGTCTCCAGATAG


Tag Tag Free
ACCN XM_054745
ORF Size 510 bp
Insert Size 4900
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 980
RefSeq ORF 510
Locus ID 4851
Cytogenetics 9q34.3
Protein Families Stem cell relevant signaling - DSL/Notch pathway, ES Cell Differentiation/IPS, Adult stem cells, Cancer stem cells, Druggable Genome
Protein Pathways Dorso-ventral axis formation, Notch signaling pathway, Prion diseases
Gene Summary This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.