p21(CDKN1A) (NM_078467) Human Untagged Clone

CAT#: SC102496

CDKN1A (untagged)-Human cyclin-dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A), transcript variant 2

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name p21(CDKN1A) (NM_078467) Human Untagged Clone
Symbol CDKN1A
Synonyms CAP20; CDKN1; CIP1; MDA-6; P21; p21CIP1; SDI1; WAF1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC102496 sequence for NM_078467 edited (data generated by NextGen Sequencing)
ATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGC
CTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGC
TGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAG
GGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACG
GGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCT
CTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTG
CCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGA
AAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCC
AAGAGGAAGCCCTAA

Clone variation with respect to NM_078467.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_078467 unedited
NGGGGTCAACAATTGTATACGACTCATATAGGCGGCCGCGAAATTCGCACGAGCCGAATC
AGTTCCTTGTGGAGCCGGAGCTGGGCGCGGATTCGCCGAGGCACCGAGGCACTCAGAGGA
GGCGCCATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGC
CGCCGCCTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATG
GCGGGCTGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCA
CTGGAGGGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTT
CCCACGGGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCA
CCTGCTCTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACC
CTTGTGCCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAG
GGTCGAAAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATC
TTCTCCAAGAGGAAGCCCTAATCCGCCCACAGGAAGCCTGCAGTCCTGGAAGCGCGAGGG
CCTCAAAGGCCCGCTCTACATCTTCTGCCTTAGTCTCAGTTTGTGTGTCTTAATTATTAT
TTGGGTTTTAAATTAAACACCTNCTCATGTACCATACCCTGGNCGNCCCCTGCCCCCCAG
CCTCTGGCATTAGAAATATTTAAACAAAACTAAGCNGNTGAAATGAGAGTTCCCTAAAGT
GCTGGGCATTNTTATTTATGAAAACTATTTAAAGCCTCTCATCCGTGTTCTNCCTTTCTT
T
3' Read Nucleotide Sequence
>OriGene 3' read for NM_078467 unedited
AATAGTTTCCTGTCCCCCCCATCGCAATANGGGGTTNNNNNNAAANNCNNNNNNNNTGNN
GGGNNNNNNTAATTTTTNTNTNTGGNGNGGGGGGGGGGTGGTTTTTTGTTGTGTGAAGGA
AGCTGTGTAAGGATATGGTAATAGTACAGGTTTTGGTCCCTGCCCTTGANAGGTTTACGG
TCTAGGTGGAGAAAGGGAATAGGTAAATGGGGAGCCGAGAAAATTTTTCCAGCCGTTGTT
ACATTTTCTGGGGGGGTTTGGGGTCAGACCCCAATACTCCAAGTACCCTAAGCACTTCAG
TGCCTCCAGGGGCTCAACATTTAGTGCCAGGAAAGACAATTATTTCTAGCCTCATATGAA
CCCACTTTGCGTGCTCTGTGTTAGCGTTTGATGAGAATATCTTAAAATGTCTGACTCTTT
GTTCAGCTGGTAATCCTAGTGAACTTAACTGGGGAGGGATGGGTTGGGATGAAGAAGGTC
ACTGGAAAGAGAGTGAACACAAGTGTGGGCGTAGGATAGAATTGTTTTAGTAGGGATATG
ATTATAATAAAATATATATTGTCAAACGTATATTTGTAGCGCGAAGAGTGAGACAAATAA
CATGAGGTCGAAAGAAAGAAGAATGAGAGGGGGGAGGTGCACGCGAGACCAAGGGAACAG
GCCCGTACAAAGCGGACCCCACCATAGACCGCAACCACATACAACCCCGAAGCCCCCGCG
GCCCGCACTGGAAGGAAGCAACAACACGAACAGCCCCCAGAGAAAAGCAGCAACCACCGA
GGTTGAAGAGACGCATACCCCAGAAAGCCACAACTTGCAAAAACAATCCACGATTAAAAT
CAAGCACAAAACTGACGCACCAAAGAGCGCCGAGAAGGGCCACCGGACCCATCGCGGAGA
GCGAAGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_078467
ORF Size 495 bp
Insert Size 2250
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_078467.1, NP_510867
RefSeq Size 2281
RefSeq ORF 495
Locus ID 1026
Cytogenetics 6p21.2
Domains CDI
Protein Families Druggable Genome
Protein Pathways ErbB signaling pathway, Cell cycle, p53 signaling pathway, Pathways in cancer, Glioma, Prostate cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia
Gene Summary This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-cyclin-dependent kinase2 or -cyclin-dependent kinase4 complexes, and thus functions as a regulator of cell cycle progression at G1. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase2, and may be instrumental in the execution of apoptosis following caspase activation. Mice that lack this gene have the ability to regenerate damaged or missing tissue. Multiple alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2015].
Transcript Variant: This variant (2) differs in the 5' UTR, lacks an in-frame portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 3. The resulting isoform (1) has a shorter N-terminus, compared to isoform 2. Variants 1, 2, 4 and 5 encode the same isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations