ADCY2 (XM_097225) Human Untagged Clone

CAT#: SC101430

(untagged)-Human LOC147343 (LOC147343)

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ADCY2 (XM_097225) Human Untagged Clone
Symbol ADCY2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for XM_097225, the custom clone sequence may differ by one or more nucleotides


ATGAAGGCAGCCGGGTCTCTCTCTGAGTGGCTGGTGCACCGGCTCATTTCTGAGTGGCCTCCTGCGTATG
AAGAAAAAGCGGCCACGTGGCATGCCTCCCTTCCCTCCCTTGCTTTCCTCTCAAAGAGCCAAGTCACGCT
GCACTGCGCTCCGTGGAGCCTTTCCCGATGGAGAAGAGAAGGGAGGCCTGAGATGTCCTTTGCTGGGATG
TGGAGAAACACCATCTATATGAAAAGCCCCTTGCTTGCTCTGCTGATTTTCTCCCTCCCCTGGCCCTGGA
GAGAAAGGCTGTGCCATTCAAAGACAGTTTGGGGACATGGGGGCTGCAGGCCTGATCTTATTTTTATGCA
AATTTTGTTCTGGGAGCAGTGGTTTATACAAACTCCTGTAGCATAA


5' Read Nucleotide Sequence
>OriGene 5' read for XM_097225 unedited
GGTTCAAATTAGTATACGACTCACTATAGGCGGCCGCGATTCGGCACGAGGGACTCCCGA
GCCCATCGTCCTGTACTCTTCTCCAGTGGGACGTCTGGCCCTCACTGTGGCTAGCTTCTG
GGCAAGTCCCTCTGCTCAAGATCACTTTATGGGGCAGCTGGTGCCCCCTGGGGCTCCCAC
ACTCTGCACATACAATTTAGGGACCTGGCAGGGTCTTGGTGGCCTGCAGCTTCCCTTTCT
GGAACCGACTCGCCTCCCATCAGAGAGCCATAACTCTTCTTCAATACAGTATTGTTTGAA
CTTTGAAATATATGCATTTGTCTATGTATTTTCTTAAAAATTAACACTGTATCTCAATAA
GCATACAATGGATTGTTCAATGGTACAGTTTGGAACCAATCCCCCGCCACTTCCCTCCCC
AAGTAAAGCCAGGACAGATGCTGGAGTCAGCATGGGAGCTGTGGAAACCTTTTGCCCTGG
AGCCAGGTGCCTGTGGCTGTGCCTGGGAGTGGCTTCAGCCCAGGCGTGGTGTCAGTTTCC
TGGCACCCCTGCCCAGGAGCCTGCATGAAGGCAGCCGGGTCTCTCTCTGAGTGGCTGGTG
CACCGGCTCATTTCTGAGTGGCCTCCTGCGTATGAAGAAAAAGCGGCCACGTGGCATGCC
TCCCTTCCCTCCCTTGCTTTCCTCTCAAAGAGCCAAGTCACGCTGCACTGCGCTCCGTGG
AGCCTTTCCCGATGGAGAAGAGAANGGAGGCCTGAGATGTCCTTTGCTGGGATGTGGAGA
AACACCATCTATATGAAAAGCCCCTTGCTTGCTCTGCTGNATTTCTCCTTCCCCTGCCCT
GNAGAGAAAGGCTGTGCCATTCANNAGACAGTTGGGGACATGGGGNCTGCAGCCCTGATC
TTATTTTTATGCAAATTTGTCTGGAGCATGGGTTATACAACNCTGA
3' Read Nucleotide Sequence
>OriGene 3' read for XM_097225 unedited
ATTGTGGACCCGCGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTACCATTTGACTGGTTTTATTAGATAGAAATTGAGGGCCGTTCAAACACAGTGACAGA
TACAAAGTACCCTGATGATGTTTTTAGGCATAGCATCACAGTCATCACTTCAGAATCACT
ACTCAAGGACAGCCACACACAAGCTGGAATTATGCTACAGGAGTTTGTATAAACCACTGC
TCCCAGAACAAAATTTGCATAAAAATAAGATCAGGCCTGCAGCCCCCATGTCCCCAAACT
GTCTTTGAATGGCACAGCCTTTCTCTCCAGGGCCAGGGGAGGGAGAAAATCAGCAGAGCA
AGCAAGGGGCTTTTCATATAGATGGTGTTTCTCCACATCCCAGCAAAGGACATCTCAGGC
CTCCCTTCTCTTCTCCATCGGGAAAGGCTCCACGGAGCGCAGTGCAGCGTGACTTGGCTC
TTTGAGAGGAAAGCAAGGGAGGGAAGGGAGGCATGCCACGTGGCCGCTTTTTCTTCATAC
GCAGGAGGCCACTCAGAAATGAGCCGGTGCACCAGCCACTCAGAGAGAGACCCGGCTGCC
TTCATGCAGGCTCCTGGGCAGGGGTGCCAGGAAACTGACACCACGCCTGGGCTGAAGCCA
CTCCCAGGCACAGCCACAGGCACCTGGCTCCAGGGCAAAAAGTTTCCACAGCTCCCATGC
TGACTNCAGCATCTGTCCTGGCTTTACTTTGGGGAGGGAAAGTGGCGGGGGATTTGGTCC
AAACCTGTACCATTGAACATCCATTGTATGCTTATTGAGATACAGTGTTAAATTTTAAGA
AAAATACATAGACAATGGCATATATTTTCAAAGTTCCAAACATACTGTAATTGAAGAAGG
AGTATGGGTTCTCTTGATGGGAGGCCAGTCCGTTCCCAAAAAGGGAAGCTGCAAGCCACC
AAGAACCTGGNCAGGTC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_097225
ORF Size 396 bp
Insert Size 1100
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 2042
RefSeq ORF 396
Locus ID 108
Cytogenetics 5p15.31
Protein Families Transmembrane, Druggable Genome
Protein Pathways Purine metabolism, Calcium signaling pathway, Chemokine signaling pathway, Oocyte meiosis, Vascular smooth muscle contraction, Gap junction, GnRH signaling pathway, Progesterone-mediated oocyte maturation, Melanogenesis, Dilated cardiomyopathy
Gene Summary This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.