IL1RA (IL1RN) (NM_173843) Human Untagged Clone

SKU
SC101242
IL1RN (untagged)-Human interleukin 1 receptor antagonist (IL1RN), transcript variant 4
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IL1RA
Synonyms DIRA; ICIL-1RA; IL-1ra; IL-1ra3; IL-1RN; IL1F3; IL1RA; IRAP; MVCD4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC101242 sequence for NM_173843 edited (data generated by NextGen Sequencing)
ATGCAAGCCTTCAGAATCTGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAA
CTAGTTGCCGGATACTTGCAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTA
CCCATTGAGCCTCATGCTCTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGTCCTGT
GTCAAGTCTGGTGATGAGACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACCTGAGC
GAGAACAGAAAGCAGGACAAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCACCACC
AGTTTTGAGTCTGCCGCCTGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAG
CCCGTCAGCCTCACCAATATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACTTCCAG
GAGGACGAGTAG

Clone variation with respect to NM_173843.2
69 t=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_173843 unedited
NGTTAGTTTTTGTNNTNNTTTTTTTTAGGGTGGNNGNGGNTTTGGTNGNGGGGGTGTTGT
TTTGTGTTGTTTGGGGGTGGCGTGGGTTTAGAGACGATCTGCCGACCCTCTGGGGAGAAA
ATCCAGCAAGATGCAAGCCTTCAGAATCTGGGATGTTAACCAGAAGACCTTCTATCTGAG
GAACAACCAACTAGTTGCCGGATACTTGCAAGGACCAAATGTCAATTTAGAAGAAAAGAT
AGATGTGGTACCCATTGAGCCTCATGCTCTGTTCTTGGGAATCCATGGAGGGAAGATGTG
CCTGTCCTGTGTCAAGTCTGGTGATGAGACCAGACTCCAGCTGGAGGCAGTTAACATCAC
TGACCTGAGCGAGAACAGAAAGCAGGACAAGCGCTTCGCCTTCATCCGCTCAGACAGTGG
CCCCACCACCAGTTTTGAGTCTGCCGCCTGCCCCGGTTGGTTCCTCTGCACAGCGCTGGG
AGCTGACCAGCCCGTCGGCCTCACCAATATGCCTGACGAAAGCGTCTGGGTCACCAAAAT
CTAGCTCCAGTAGGACCAGGTGTGCTGCCCAGGCCCGGGCCGATCCCCTTCCTCGATGGG
CAGGGACCGCAGGCACTGCACAGTCCCCCTGCCCCCGGGGCTCCCCGCCTTTGGCGCCCC
CTGGCGCACACACCCTTGAGGCGCCGGACCCCCACAAAGCGTCCGCGGCACCGGGGAAGC
GGGGACGTGCGCCTCCCCGGCGACGGACGAGGCCGCCCAGCTCGCCCCCCCACAGGGACG
TTAAGAGGGGGCACACTCGGAGCAACGAGAGCCACGGGCACAAGGCCTTTCCCCGTCGCC
TCGGATATGAGTAGAACACGACCCGAGACACCATGGAACAAACTGGTACGACTCTTCTGA
AACAGGGTTCATCCTCACCGATATTACAACCAACACCGGCGCCAGCAAACACCCG
Restriction Sites Please inquire
ACCN NM_173843
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_173843.1, NP_776215.1
RefSeq Size 1973 bp
RefSeq ORF 432 bp
Locus ID 3557
UniProt ID P18510
Cytogenetics 2q14.1
Protein Families Druggable Genome, Secreted Protein
Summary The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses, particularly in the acute phase of infection and inflammation. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (4) contains a distinct internal exon compared to variant 2. This results in translation from a downstream start codon, and an isoform (4) that has a shorter N-terminus, as compared to the longest isoform (2). Variants 4 and 5 both encode the same isoform (4).
Write Your Own Review
You're reviewing:IL1RA (IL1RN) (NM_173843) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202447 IL1RN (Myc-DDK-tagged)-Human interleukin 1 receptor antagonist (IL1RN), transcript variant 4 10 ug
$150.00
RC202447L1 Lenti ORF clone of Human interleukin 1 receptor antagonist (IL1RN), transcript variant 4, Myc-DDK-tagged 10 ug
$450.00
RC202447L2 Lenti ORF clone of Human interleukin 1 receptor antagonist (IL1RN), transcript variant 4, mGFP tagged 10 ug
$450.00
RC202447L3 Lenti ORF clone of Human interleukin 1 receptor antagonist (IL1RN), transcript variant 4, Myc-DDK-tagged 10 ug
$450.00
RC202447L4 Lenti ORF clone of Human interleukin 1 receptor antagonist (IL1RN), transcript variant 4, mGFP tagged 10 ug
$450.00
RG202447 IL1RN (tGFP-tagged) - Human interleukin 1 receptor antagonist (IL1RN), transcript variant 4 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.