CD20 (MS4A1) (NM_152866) Human Untagged Clone

SKU
SC101205
MS4A1 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CD20
Synonyms B1; Bp35; CD20; CVID5; FMC7; LEU-16; MS4A2; S7
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC101205 sequence for NM_152866 edited (data generated by NextGen Sequencing)
ATGACAACACCCAGAAATTCAGTAAATGGGACTTTCCCGGCAGAGCCAATGAAAGGCCCT
ATTGCTATGCAATCTGGTCCAAAACCACTCTTCAGGAGGATGTCTTCACTGGTGGGCCCC
ACGCAAAGCTTCTTCATGAGGGAATCTAAGACTTTGGGGGCTGTCCAGATTATGAATGGG
CTCTTCCACATTGCCCTGGGGGGTCTTCTGATGATCCCAGCAGGGATCTATGCACCCATC
TGTGTGACTGTGTGGTACCCTCTCTGGGGAGGCATTATGTATATTATTTCCGGATCACTC
CTGGCAGCAACGGAGAAAAACTCCAGGAAGTGTTTGGTCAAAGGAAAAATGATAATGAAT
TCATTGAGCCTCTTTGCTGCCATTTCTGGAATGATTCTTTCAATCATGGACATACTTAAT
ATTAAAATTTCCCATTTTTTAAAAATGGAGAGTCTGAATTTTATTAGAGCTCACACACCA
TATATTAACATATACAACTGTGAACCAGCTAATCCCTCTGAGAAAAACTCCCCATCTACC
CAATACTGTTACAGCATACAATCTCTGTTCTTGGGCATTTTGTCAGTGATGCTGATCTTT
GCCTTCTTCCAGGAACTTGTAATAGCTGGCATCGTTGAGAATGAATGGAAAAGAACGTGC
TCCAGACCCAAATCTAACATAGTTCTCCTGTCAGCAGAAGAAAAAAAAGAACAGACTATT
GAAATAAAAGAAGAAGTGGTTGGGCTAACTGAAACATCTTCCCAACCAAAGAATGAAGAA
GACATTGAAATTATTCCAATCCAAGAAGAGGAAGAAGAAGAAACAGAGACGAACTTTCCA
GAACCTCCCCAAGATCAGGAATCCTCACCAATAGAAAATGACAGCTCTCCTTAA

Clone variation with respect to NM_152866.2
Restriction Sites Please inquire
ACCN NM_152866
Insert Size 3000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152866.2, NP_690605.1
RefSeq Size 3594 bp
RefSeq ORF 894 bp
Locus ID 931
UniProt ID P11836
Cytogenetics 11q12.2
Domains CD20
Protein Families Druggable Genome, Transmembrane
Protein Pathways Hematopoietic cell lineage
Summary This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript variant. Variants 1 and 3 both encode the same protein.
Write Your Own Review
You're reviewing:CD20 (MS4A1) (NM_152866) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221570 MS4A1 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC221570L1 Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC221570L2 Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1, mGFP tagged 10 ug
$600.00
RC221570L3 Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC221570L4 Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG221570 MS4A1 (tGFP-tagged) - Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.