SP1 (NM_138473) Human Untagged Clone

CAT#: SC101137

Reviews ()
Write a review

SP1 (untagged)-Human Sp1 transcription factor (SP1), transcript variant 1



  "NM_138473" in other vectors (6)

Reconstitution Protocol

USD 1,079.00

In Stock*

Size
    • 10 ug

Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SP1
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_138473 edited
TCGGCACGAGGCTTGCCTCGTCAGCGTCCGCGTTTTTCCCGGCCCCCCCCAACCCCCCCG
GACAGGACCCCCTTGAGCTTGTCCCTCAGCTGCCACCATGAGCGACCAAGATCACTCCAT
GGATGAAATGACAGCTGTGGTGAAAATTGAAAAAGGAGTTGGTGGCAATAATGGGGGCAA
TGGTAATGGTGGTGGTGCCTTTTCACAGGCTCGAAGTAGCAGCACAGGCAGTAGCAGCAG
CACTGGAGGAGGAGGGCAGGAGTCCCAGCCATCCCCTTTGGCTCTGCTGGCAGCAACTTG
CAGCAGAATTGAGTCACCCAATGAGAACAGCAACAACTCCCAGGGCCCGAGTCAGTCAGG
GGGAACAGGTGAGCTTGACCTCACAGCCACACAACTTTCACAGGGTGCCAATGGCTGGCA
GATCATCTCTTCCTCCTCTGGGGCTACCCCTACCTCAAAGGAACAGAGTGGCAGCAGTAC
CAATGGCAGCAATGGCAGTGAGTCTTCCAAGAATCGCACAGTCTCTGGTGGGCAGTATGT
TGTGGCTGCCGCTCCCAACTTACAGAACCAGCAAGTTCTGACAGGACTACCTGGAGTGAT
GCCTAATATTCAGTATCAAGTAATCCCACAGTTCCAGACCGTTGATGGGCAACAGCTGCA
GTTTGCTGCCACTGGGGCCCAAGTGCAGCAGGATGGTTCTGGTCAAATACAGATCATACC
AGGTGCAAACCAACAGATTATCACAAATCGAGGAAGTGGAGGCAACATCATTGCTGCTAT
GCCAAACCTACTCCAGCAGGCTGTCCCCCTCCAAGGCCTGGCTAATAATGTACTCTCAGG
ACAGACTCAGTATGTGACCAATGTACCAGTGGCCCTGAATGGGAACATCACCTTGCTACC
TGTCAACAGCGTTTCTGCAGCTACCTTGACTCCCAGCTCTCAGGCAGTCACGATCAGCAG
CTCTGGGTCCCAGGAGAGTGGCTCACAGCCTGTCACCTCAGGGACTACCATCAGTTCTGC
CAGCTTGGTATCATCACAAGCCAGTTCCAGCTCCTTTTTCACCAATGCCAATAGCTACTC
AACTACTACTACCACCAGCAACATGGGAATTATGAACTTTACTACCAGTGGATCATCAGG
GACCAACTCTCAAGGCCAGACACCCCAGAGGGTCAGTGGGCTACAGGGGTCTGATGCTCT
GAACATCCAGCAAAACCAGACATCTGGAGGCTCATTGCAAGCAGGCCAGCAAAAAGAAGG
AGAGCAAAACCAGCAGACACAGCAGCAACAAATTCTTATCCAGCCTCAGCTAGTTCAAGG
GGGACAGGCCCTCCAGGCCCTCCAAGCAGCACCATTGTCAGGGCAGACCTTTACAACTCA
AGCCATCTCCCAGGAAACCCTCCAGAACCTCCAGCTTCAGGCTGTTCCAAACTCTGGTCC
CATCATCATCCGGACACCAACAGTGGGGCCCAATGGACAGGTCAGTTGGCAGACTCTACA
GCTGCAGAACCTCCAAGTTCAGAACCCACAAGCCCAAACAATCACCTTAGCCCCAATGCA
GGGTGTTTCCTTGGGGCAGACCAGCAGCAGCAACACCACTCTCACACCCATTGCCTCAGC
TGCTTCCATTCCTGCTGGCACAGTCACTGTGAATGCTGCTCAACTCTCCTCCATGCCAGG
CCTCCAGACCATTAACCTCAGTGCATTGGGTACTTCAGGAATCCAGGTGCACCCAATTCA
AGGCCTGCCGTTGGCTATAGCAAATGCCCCAGGTGATCATGGAGCTCAGCTTGGTCTCCA
TGGGGCTGGTGGTGATGGAATACATGATGACACAGCAGGTGGAGAGGAAGGAGAAAACAG
CCCAGATGCCCAACCCCAAGCCGGTCGGAGGACCCGGCGGGAAGCATGCACCTGCCCCTA
CTGTAAAGACAGTGAAGGAAGGGGCTCGGGGGATCCTGGCAAAAAGAAACAGCATATTTG
CCACATCCAAGGCTGTGGGAAAGTGTATGGCAAGACCTCTCACCTGCGGGCACACTTGCG
CTGGCATACAGGCGAGAGGCCATTTATGTGTACCTGGTCATACTGTGGGAAACGCTTCAC
ACGTTCGGATGAGCTACAGAGGCACAAACGTACACACACAGGTGAGAAGAAATTTGCCTG
CCCTGAGTGTCCTAAGCGCTTCATGAGGAGTGACCACCTGTCAAAACATATCAAGACCCA
CCAGAATAAGAAGGGAGGCCCAGGTGTAGCTCTGAGTGTGGGCACTTTGCCCCTGGACAG
TGGGGCAGGTTCAGAAGGCAGTGGCACTGCCACTCCTTCAGCCCTTATTACCACCAATAT
GGTAGCCATGGAGGCCATCTGTCCAGAGGGCATTGCCCGTCTTGCCAACAGTGGCATCAA
CGTCATGCAGGTGGCAGATCTGCAGTCCATTAATATCAGTGGCAATGGCTTCTGAGATCA
GGCACCCGGGGCCAGAGACATATGGGCCATACCCCTTAACCCCGGGATGCAAGGTAGCAT
GGGTCCAAGAGACATGGAAGAGAGAGCCATGAAGC
>OriGene 5' read for NM_138473 unedited
NGGGGGGAAGGGGNNNNNNNNNNNNNCTCCCCCNNNTTTTCTTACACCCGCCCGTTGNCG
CAAAGGGCGGTAGGCGTGTACGGTGGGNAGTCTATATAAGCAGAGCTCATTTAGGTGACA
CTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGAATTCGGCACGAGGCTTGC
CTCGTCAGCGTCCGCGTTTTTCCCGGCCCCCCCCAACCCCCCCGGACAGGACCCCCTTGA
GCTTGTCCCTCAGCTGCCACCATGAGCGACCAAGATCACTCCATGGATGAAATGACAGCT
GTGGTGAAAATTGAAAAAGGAGTTGGTGGCAATAATGGGGGCAATGGTAATGGTGGTGGT
GCCTTTTCACAGGCTCGAAGTAGCAGCACAGGCAGTAGCAGCAGCACTGGAGGAGGAGGG
CAGGAGTCCCAGCCATCCCCTTTGGCTCTGCTGGCAGCAACTTGCAGCAGAATTGAGTCA
CCCAATGAGAACAGCAACAACTCCCAGGGCCCGAGTCAGTCAGGGGGAACAGGTGAGCTT
GACCTCACAGCCACACAACTTTCACAGGGTGCCAATGGCTGGCAGATCATCTCTTCCTCC
TCTGGGGCTACCCCTACCTCAAAGGAACAGAGTGGCAGCAGTACCAATGGCAGCAATGGC
AGTGAGTCTTCCAAGAATCGCACAGTCTCTGGTGGGCAGTATGTTGTGGCTGCCGCTCCC
AACTTACAGAACCAGCAAGTTCTGACAGGACTACCTGGAGTGATGCCTAATATTCAGTAT
CAAGTAATCCCACAGTTCCAGACCGTTGATGGGCAACAGCTGCAGTTTGCTGCCACTGGG
GCCCAAGTGCAGCAGGATGGGTTCTGGTCAAATACAGATCACTACCAGTGCAAACCAACA
GATTATCACAAATCGAGGAAGTGGNAGGCACATCATTGCTGCTATGCCAAACCT
>OriGene 3' read for NM_138473 unedited
CTCCTTATGTACGCGGCCGCAATTCTANGATCGGTTTTTTTTTTTTTTTTTTCCCCTGAT
ACTTAGCTAGGACTTAGGGCAGTTGAGAGGCAGATCATCATGCCTCTACTTTCTTAGCAG
AGACAAGGAAGACTGGGGCTGTTTGATAATGAGGAAGGGGAAAATGGGACAAAATACTCC
TCTTTCAAATGAACACTGTGGAGAAAATCTTTCTGGGTTTGGGGAAGTCAGAGTAAAGAC
TTAGGGGAGTAATAAAGCCAGAGACCCCCCTTCTTTTCCTTTCCCTGCCTTGGATCTAAG
GCAAGTGAGCCAAATTTGGAAGAGGGAGTAGGAATTTAAGCTTAAGGCTGCTTAATGTCT
TCCTGGGGGCTGGTGTTTTGGGAAGGCAGACAAAGAGAAACAGGTCAACCTCAAAGCTGG
TCTGCTCATCCTCTTAGAAGAGGTCTGGTATCTGTGGAGTAGAGCCAAGAGAGGCACCAC
AGAGAGCACAGTCTCCCAAACAGAAGTAATAACCGGCTCATATTTTATCAGCAGTTTTCA
AAAGCAATGTTTTCCGGGGTTGGAGAAGTGCCATATCTTCCTCCCTTTCCCCAAAGCTAC
TGCTGCGACCTTTCTTTCATCCTTGTACATAAGTTACTGGCTCTCTTCTAAGGGAGATAA
ATTCTGAGATTTCACATTTTCCCTCTCAACCCCAATAGGCTACCCAGCTTCAGTGAGGGG
GAAGGAGAGCTATGCAAAGGGCCCCTCACTTGAGGCAGCTAGACTGTCCTTATTTCCTTG
GTACCTGATCTCCAAAACTCTTGATCTGATCCCAAGGTCCAAAAGGCATCAGGNTACTTA
CACTGAANACTTNCAAGCAGTAGCACCAGGGCTCCCCCTAAAGCATACAGGNGCCTGATT
AGCACCCAGAATGATCCCT
Restriction Sites NotI-NotI     
ACCN NM_138473
Insert Size 7000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138473.2, NP_612482.2
RefSeq Size 7667 bp
RefSeq ORF 2358 bp
Locus ID 6667
UniProt ID P08047
Cytogenetics 12q13.13
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Stem cell - Pluripotency, Stem cell relevant signaling - JAK/STAT signaling pathway, Transcription Factors
Protein Pathways Huntington's disease, TGF-beta signaling pathway
Gene Summary The protein encoded by this gene is a zinc finger transcription factor that binds to GC-rich motifs of many promoters. The encoded protein is involved in many cellular processes, including cell differentiation, cell growth, apoptosis, immune responses, response to DNA damage, and chromatin remodeling. Post-translational modifications such as phosphorylation, acetylation, glycosylation, and proteolytic processing significantly affect the activity of this protein, which can be an activator or a repressor. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.