C1orf85 (GLMP) (NM_144580) Human Untagged Clone

SKU
SC100930
C1orf85 (untagged)-Human chromosome 1 open reading frame 85 (C1orf85)
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C1orf85
Synonyms C1orf85; NCU-G1
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_144580, the custom clone sequence may differ by one or more nucleotides


ATGCGCGGCTCTGTGGAGTGCACCTGGGGTTGGGGGCACTGTGCCCCCAGCCCCCTGCTCCTTTGGACTC
TACTTCTGTTTGCAGCCCCATTTGGCCTGCTGGGGGAGAAGACCCGCCAGGTGTCTCTGGAGGTCATCCC
TAACTGGCTGGGCCCCCTGCAGAACCTGCTTCATATACGGGCAGTGGGCACCAATTCCACACTGCACTAT
GTGTGGAGCAGCCTGGGGCCTCTGGCAGTGGTAATGGTGGCCACCAACACCCCCCACAGCACCCTGAGCG
TCAACTGGAGCCTCCTGCTATCCCCTGAGCCCGATGGGGGCCTGATGGTGCTCCCTAAGGACAGCATTCA
GTTTTCTTCTGCCCTTGTTTTTACCAGGCTGCTTGAGTTTGACAGCACCAACGTGTCCGATACGGCAGCA
AAGCCTTTGGGAAGACCATATCCTCCATACTCCTTGGCCGATTTCTCTTGGAACAACATCACTGATTCAT
TGGATCCTGCCACCCTGAGTGCCACATTTCAAGGCCACCCCATGAACGACCCTACCAGGACTTTTGCCAA
TGGCAGCCTGGCCTTCAGGGTCCAGGCCTTTTCCAGGTCCAGCCGACCAGCCCAACCCCCTCGCCTCCTG
CACACAGCAGACACCTGTCAGCTAGAGGTGGCCCTGATTGGAGCCTCTCCCCGGGGAAACCGTTCCCTGT
TTGGGCTGGAGGTAGCCACATTGGGCCAGGGCCCTGACTGCCCCTCAATGCAGGAGCAGCACTCCATCGA
CGATGAATATGCACCGGCCGTCTTCCAGTTGGACCAGCTACTGTGGGGCTCCCTCCCATCAGGCTTTGCA
CAGTGGCGACCAGTGGCTTACTCCCAGAAGCCGGGGGGCCGAGAATCAGCCCTGCCCTGCCAAGCTTCCC
CTCTTCATCCTGCCTTAGCATACTCTCTTCCCCAGTCACCCATTGTCCGAGCCTTCTTTGGGTCCCAGAA
TAACTTCTGTGCCTTCAATCTGACGTTCGGGGCTTCCACAGGCCCTGGCTATTGGGACCAACACTACCTC
AGCTGGTCGATGCTCCTGGGTGTGGGCTTCCCTCCAGTGGACGGCTTGTCCCCACTAGTCCTGGGCATCA
TGGCAGTGGCCCTGGGTGCCCCAGGGCTCATGCTGCTAGGGGGCGGCTTGGTTCTGCTGCTGCACCACAA
GAAGTACTCAGAGTACCAGTCCATAAATTAA


Restriction Sites NotI-NotI
ACCN NM_144580
Insert Size 2000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_144580.1, NP_653181.1
RefSeq Size 1603 bp
RefSeq ORF 1221 bp
Locus ID 112770
UniProt ID Q8WWB7
Cytogenetics 1q22
Protein Families Transmembrane
Summary Required to protect lysosomal transporter MFSD1 from lysosomal proteolysis and for MFSD1 lysosomal localization.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1).
Write Your Own Review
You're reviewing:C1orf85 (GLMP) (NM_144580) Human Untagged Clone
Your Rating
SKU Description Size Price
RC205863 C1orf85 (Myc-DDK-tagged)-Human chromosome 1 open reading frame 85 (C1orf85) 10 ug
$686.00
RC205863L1 Lenti ORF clone of Human chromosome 1 open reading frame 85 (C1orf85), Myc-DDK-tagged 10 ug
$986.00
RC205863L2 Lenti ORF clone of Human chromosome 1 open reading frame 85 (C1orf85), mGFP tagged 10 ug
$986.00
RC205863L3 Lenti ORF clone of Human chromosome 1 open reading frame 85 (C1orf85), Myc-DDK-tagged 10 ug
$986.00
RC205863L4 Lenti ORF clone of Human chromosome 1 open reading frame 85 (C1orf85), mGFP tagged 10 ug
$986.00
RG205863 C1orf85 (tGFP-tagged) - Human chromosome 1 open reading frame 85 (C1orf85) 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.