SKP1 (NM_170679) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | SKP1 |
Synonyms | EMC19; OCP-II; OCP2; p19A; SKP1A; TCEB1L |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_170679, the custom clone sequence may differ by one or more nucleotides
ATGCCTTCAATTAAGTTGCAGAGTTCTGATGGAGAGATATTTGAAGTTGATGTGGAAATTGCCAAACAAT CTGTGACTATTAAGACCATGTTGGAAGATTTGGGAATGGATGATGAAGGAGATGATGACCCAGTTCCTCT ACCAAATGTGAATGCAGCAATATTAAAAAAGGTCATTCAGTGGTGCACCCACCACAAGGATGACCCTCCT CCTCCTGAAGATGATGAGAACAAAGAAAAGCGAACAGATGATATCCCTGTTTGGGACCAAGAATTCCTGA AAGTTGACCAAGGAACACTTTTTGAACTCATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGA TGTTACATGCAAGACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGAGATTCGCAAGACCTTCAAT ATCAAAAATGACTTTACTGAAGAGGAGGAAGCCCAGGTACGCAAAGAGAACCAGTGGTGTGAAGAGAAGT GA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_170679 unedited
CTCCTATAGGGCGGCCGCGAATTCGCACGAGGGCGCTGCGACGCTGTAGTGGCTTCGTCT TCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGTCAGCCTCCCGCCGGCCGTC TCCTTAACACCGAACACCATGCCTTCAATTAAGTTGCAGAGTTCTGATGGAGAGATATTT GAAGTTGATGTGGAAATTGCCAAACAATCTGTGACTATTAAGACCATGTTGGAAGATTTG GGAATGGATGATGAAGGAGATGATGACCCAGTTCCTCTACCAAATGTGAATGCAGCAATA TTAAAAAAGGTCATTCAGTGGTGCACCCACCACAAGGATGACCCTCCTCCTCCTGAAGAT GATGAGAACAAAGAAAAGCGAACAGATGATATCCCTGTTTGGGACCAAGAATTCCTGAAA GTTGACCAAGGAACACTTTTTGAACTCATTCTGGCTGCAAACTACTTAGACATCAAAGGT TTGCTTGATGTTACATGCAAGCACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGA GATTCGCAAGACCTTCAATAGCAAAAATGACTTTACTGAAGAGGAGGAAGCCCAGGTACG CAAAGAGAACCAGTGGTGTGAAGAGAAGTGAAATGTTGTGCCTGACACTGTAACACTGTA AGGATTGTTCCAAATACTAGTTGCACTGCTCTGTTTATAATTGTTAATATTAGACCAACA GTAGACAAATGCAGCAGCAAGTCAATTGTATTAGCAGAATATTGTCCTCATTGCATGTTG TAGTTTGAGCACAGATCCCANACCTACGGNNCAGTTTCTTCTAGTATGAGGGAAAATTNC TTTTTTCTTTGCTCTGATAAACTGAACGGGGGGTCTCTATAAGGGNCATT |
Restriction Sites | NotI-NotI |
ACCN | NM_170679 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_170679.1, NP_733779.1 |
RefSeq Size | 1486 bp |
RefSeq ORF | 492 bp |
Locus ID | 6500 |
UniProt ID | P63208 |
Cytogenetics | 5q31.1 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle, Oocyte meiosis, TGF-beta signaling pathway, Ubiquitin mediated proteolysis, Wnt signaling pathway |
Summary | This gene encodes a component of SCF complexes, which are composed of this protein, cullin 1, a ring-box protein, and one member of the F-box family of proteins. This protein binds directly to the F-box motif found in F-box proteins. SCF complexes are involved in the regulated ubiquitination of specific protein substrates, which targets them for degradation by the proteosome. Specific F-box proteins recognize different target protein(s), and many specific SCF substrates have been identified including regulators of cell cycle progression and development. Studies have also characterized the protein as an RNA polymerase II elongation factor. Alternative splicing of this gene results in two transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) utilizes an alternate splice site in the 3' coding region, compared to variant 1. This results in a frameshift and slightly longer protein (isoform b), compared to isoform a. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC209385 | SKP1 (Myc-DDK-tagged)-Human S-phase kinase-associated protein 1 (SKP1), transcript variant 2 | 10 ug |
$150.00
|
|
RC209385L1 | Lenti ORF clone of Human S-phase kinase-associated protein 1 (SKP1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC209385L2 | Lenti ORF clone of Human S-phase kinase-associated protein 1 (SKP1), transcript variant 2, mGFP tagged | 10 ug |
$450.00
|
|
RC209385L3 | Lenti ORF clone of Human S-phase kinase-associated protein 1 (SKP1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC209385L4 | Lenti ORF clone of Human S-phase kinase-associated protein 1 (SKP1), transcript variant 2, mGFP tagged | 10 ug |
$450.00
|
|
RG209385 | SKP1 (tGFP-tagged) - Human S-phase kinase-associated protein 1 (SKP1), transcript variant 2 | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.