Mitochondrial ribosomal protein L11 (MRPL11) (NM_016050) Human Untagged Clone

SKU
SC100687
MRPL11 (untagged)-Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Mitochondrial ribosomal protein L11
Synonyms CGI-113; L11MT; MRP-L11
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_016050 edited
ATGTCAAAGCTCGGCCGGGCCGCCCGGGGCCTCAGGAAGCCCGAGGTCGGCGGTGTGATC
CGGGCGATCGTGCGGGCAGGCCTGGCCATGCCCGGGCCCCCACTAGGCCCAGTGCTGGGT
CAGAGAGGCGTTTCCATCAACCAGTTTTGCAAGGAGTTCAATGAGAGGACAAAGGACATC
AAGGAAGGCATTCCTCTGCCTACCAAGATTTTAGTGAAGCCTGACAGGACATTTGAAATT
AAGATTGGACAGCCCACTGTTTCCTACTTCCTGAAGGCAGCAGCTGGGATTGAAAAGGGG
GCCCGGCAAACAGGGAAAGAGGTGGCAGGCCTGGTGACCTTGAAGCATGTGTATGAGATT
GCCCGCATCAAAGCTCAGGATGAGGCATTTGCCCTGCAGGATGTACCCCTGTCGTCTGTT
GTCCGCTCCATCATCGGGTCTGCCCGTTCTCTGGGCATTCGCGTGGTGAAGGACCTCAGT
TCAGAAGAGCTTGCAGCTTTCCAGAAGGAACGAGCCATCTTCCTGGCTGCTCAGAAGGAG
GCAGATTTGGCTGCCCAAGAAGAAGCTGCCAAGAAGTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_016050 unedited
CACGAGGCTGAAGCCAGCAGCCCCGCATCATGTCAAAGCTCGGCCGGGCCGCCCGGGGCC
TCAGGAAGCCCGAGGTCGGCGGTGTGATCCGGGCGATCGTGCGGGCAGGCCTGGCCATGC
CCGGGCCCCCACTAGGCCCAGTGCTGGGTCAGAGAGGCGTTTCCATCAACCAGTTTTGCA
AGGAGTTCAATGAGAGGACAAAGGACATCAAGGAAGGCATTCCTCTGCCTACCAAGATTT
TAGTGAAGCCTGACAGGACATTTGAAATTAAGATTGGACAGCCCACTGTTTCCTACTTCC
TGAAGGCAGCAGCTGGGATTGAAAAGGGGGCCCGGCAAACAGGGAAAGAGGTGGCAGGCC
TGGTGACCTTGAAGCATGTGTATGAGATTGCCCGCATCAAAGCTCAGGATGAGGCATTTG
CCCTGCAGGATGTACCCCTGTCGTCTGTTGTCCGCTCCATCATCGGGTCTGCCCGTTCTC
TGGGCATTCGCGTGGTGAAGGACCTCAGTTCAGAAGAGCTTGCAGCTTTCCAGAAGGAAC
GAGCCATCTTCCTGGCTGCTCAGAAGGAGGCAGATTTGGCTGCCCAAGAAGAAGCTGCCA
AGAAGTGACCCTTGCCCCACCAACTCC
Restriction Sites NotI-NotI
ACCN NM_016050
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016050.2, NP_057134.1
RefSeq Size 840 bp
RefSeq ORF 579 bp
Locus ID 65003
UniProt ID Q9Y3B7
Cytogenetics 11q13.2
Domains Ribosomal_L11
Summary This nuclear gene encodes a 39S subunit component of the mitochondial ribosome. Alternative splicing results in multiple transcript variants. Pseudogenes for this gene are found on chromosomes 5 and 12. [provided by RefSeq, May 2014]
Transcript Variant: This variant (1) encodes the longest isoform (a).
Write Your Own Review
You're reviewing:Mitochondrial ribosomal protein L11 (MRPL11) (NM_016050) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200033 MRPL11 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$300.00
RC200033L1 Lenti ORF clone of Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200033L2 Lenti ORF clone of Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$600.00
RC200033L3 Lenti ORF clone of Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200033L4 Lenti ORF clone of Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$600.00
RG200033 MRPL11 (tGFP-tagged) - Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.