ISCU (NM_014301) Human Untagged Clone

SKU
SC100422
ISCU (untagged)-Human iron-sulfur cluster scaffold homolog (E. coli) (ISCU), nuclear gene encoding mitochondrial protein, transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ISCU
Synonyms 2310020H20Rik; HML; hnifU; ISU2; NIFU; NIFUN
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC100422 sequence for NM_014301 edited (data generated by NextGen Sequencing)
ATGGTTCTCATTGACATGAGTGTAGACCTTTCTACTCAGGTTGTTGATCATTATGAAAAT
CCTAGAAACGTGGGGTCCCTTGACAAGACATCTAAAAATGTTGGAACTGGACTGGTGGGG
GCTCCAGCATGTGGTGACGTAATGAAATTACAGATTCAAGTGGATGAAAAGGGGAAGATT
GTGGATNNNAGGTTTAAAACATTTGGCTGTGGTTCCGCAATTGCCTCCAGCTCATTAGCC
ACTGAATGGGTGAAAGGAAAGACGGTGGAGGAAGCCTTGACTATCAAAAACACAGATATC
GCCAAGGAGCTCTGCCTTCCTCCCGTGAAACTGCACTGCTCCATGCTGGCTGAAGATGCA
ATCAAGGCCGCCCTGGCTGATTACAAATTGAAACAAGAACCCAAAAAAGGAGAGGCAGAG
AAGAAATGA

Clone variation with respect to NM_014301.3
187 g=>n;188 c=>n;189 t=>n
5' Read Nucleotide Sequence
>OriGene 5' read for NM_014301 unedited
GCGGTGCACCAATTGTAAACGACTCACTATAGGCGGCCGCGAATCGGCACGAGGGCGCGC
TCCCAGCTCGGAGCCGACTCGCAGACGCGCCCCGCCCCTCGGCGTCGCTCTGGACTGGCG
CAGGCGCAAGCCGGCAAGATGGCGGCGGCTGGGGCTGGCCGTCTGAGGCGGGTGGCATCG
GCTCTGCTGCTGCGGAGCCCCCGCCTGCCCGCCCGGGAGCTGTCGGCCCCGGCCCGACTC
TATCACAAGAAGGTAGGGACAAAAGAGGGGACGCGCGGAATGCCGACTCAGCGGAGGCCT
GGGCTGGAGGGGCGGCCGCGGGGTTCTGCGCAGCTAGGACTGGGAGCTGTGCCCTCCCAC
GTCTTTGCCCTGACTCGCTTTCCCTTGCTGCGCAGTGAGGCTCACTGCAACTGATAAACA
ACAGTTACCGCTCATCGGGCGGCGACTTCCAGGGGGCCCCGCCGCTGGCCGCGACTTCGT
GCGTCCCAATTTTAAATTCGCCAACAGCCCAGGAGGCAGGGTCCTGTTGGGACTTGTCTT
TCTGAGTCCAGGGACAGACACACCCCCGGAGCGGGCTCCGGCTTCAGCCACTCCGCTGCC
CTGGCCAGATGACCTTGGGCTAGTCACTGCGCCTCTCTGAACCTGTTTCCCCAGGTGTAA
ATGGGGGGCTCTCAGCTGTCCCTTCCAAGGATACTGTGCGTGGAGTCCTGGCATGGTTCC
TGGCACATANGCCCCAGCACGAGGAGACCGTTTCTGTTACTGCNTTANGAGTGCATAAGG
GAGTCAGGGCTGTTACCAACATGCGTANATGTTTTTGTTTGTTTGGGGGGGTTTTTTGGC
GGGGAAAGAGGGATAGATTCATAGTCTGCAGCCCCTTGCTGTCTGGTGGCCCAAAGTCCC
CCANACGTGAAACTC
Restriction Sites NotI-NotI
ACCN NM_014301
Insert Size 4300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014301.2, NP_055116.1
RefSeq Size 1086 bp
RefSeq ORF 429 bp
Locus ID 23479
UniProt ID Q9H1K1
Cytogenetics 12q23.3
Domains NifU_N
Summary This gene encodes a component of the iron-sulfur (Fe-S) cluster scaffold. Fe-S clusters are cofactors that play a role in the function of a diverse set of enzymes, including those that regulate metabolism, iron homeostasis, and oxidative stress response. Alternative splicing results in transcript variants encoding different protein isoforms that localize either to the cytosol or to the mitochondrion. Mutations in this gene have been found in patients with hereditary myopathy with lactic acidosis. A disease-associated mutation in an intron may activate a cryptic splice site, resulting in the production of a splice variant encoding a putatively non-functional protein. A pseudogene of this gene is present on chromosome 1. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) contains an alternate exon in the 5' region and initiates translation at an alternate start codon compared to variant 2. The encoded isoform (1) has a distinct, shorter N-terminus, compared to isoform 2. Isoform 1 is localized to the cytosol.
Write Your Own Review
You're reviewing:ISCU (NM_014301) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212031 ISCU (Myc-DDK-tagged)-Human iron-sulfur cluster scaffold homolog (E. coli) (ISCU), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$150.00
RC212031L3 Lenti ORF clone of Human iron-sulfur cluster scaffold homolog (E. coli) (ISCU), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC212031L4 Lenti ORF clone of Human iron-sulfur cluster scaffold homolog (E. coli) (ISCU), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$450.00
RG212031 ISCU (tGFP-tagged) - Human iron-sulfur cluster scaffold homolog (E. coli) (ISCU), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.