Ace2 (NM_001012006) Rat Untagged Clone

CAT#: RN214151

Reviews ()
Write a review

Ace2 (untagged ORF) - Rat angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 (Ace2), (10 ug)



  "NM_001012006" in other vectors (3)

Reconstitution Protocol

USD 1,232.00


Availability*
6 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Ace2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214151 representing NM_001012006
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCAAGCTCCTGCTGGCTCCTTCTCAGCCTTGTTGCTGTTGCTACTGCTCAGTCCCTCATCGAGGAAA
AGGCCGAGAGCTTTTTAAACAAGTTTAACCAGGAAGCTGAAGACCTGTCTTATCAAAGTTCACTTGCTTC
TTGGAATTACAACACCAACATTACGGAGGAGAATGCCCAAAAGATGAACGAGGCTGCGGCCAAATGGTCT
GCCTTTTATGAAGAACAGTCCAAGATCGCCCAAAATTTCTCACTACAAGAAATTCAGAATGCGACCATCA
AGCGTCAACTGAAGGCCCTTCAGCAGAGCGGGTCTTCAGCGCTGTCACCAGACAAGAACAAACAGTTGAA
CACAATTCTAAACACCATGAGCACCATTTACAGTACTGGAAAAGTTTGCAACTCAATGAATCCACAAGAA
TGTTTTTTACTTGAACCAGGATTGGACGAAATAATGGCAACAAGCACAGACTACAATCGTAGGCTCTGGG
CTTGGGAGGGCTGGAGGGCTGAGGTCGGCAAGCAGCTGAGGCCGTTATATGAAGAGTATGTGGTCCTGAA
AAATGAGATGGCAAGAGCAAACAATTATGAAGACTATGGGGATTATTGGCGAGGGGATTATGAAGCAGAG
GGAGTAGAAGGTTACAACTACAACCGAAACCAGTTGATCGAAGACGTAGAAAATACCTTCAAAGAGATCA
AACCGTTGTATGAGCAACTTCATGCCTATGTGAGAACGAAGTTGATGGAAGTGTACCCTTCTTACATCAG
CCCTACTGGATGCCTCCCTGCTCATTTGCTTGGTGATATGTGGGGTAGGTTTTGGACAAATCTGTACCCT
TTGACTACTCCCTTTCTTCAGAAACCAAACATAGATGTTACTGATGCAATGGTGAATCAGAGCTGGGATG
CAGAAAGAATATTTAAAGAGGCAGAGAAGTTCTTCGTTTCTGTTGGCCTTCCTCAAATGACTCCGGGATT
CTGGACAAACTCCATGCTGACTGAGCCAGGAGATGACCGGAAAGTTGTCTGCCACCCCACAGCTTGGGAT
CTGGGACATGGAGACTTCAGAATCAAGATGTGCACAAAGGTCACAATGGACAACTTCTTGACAGCCCATC
ATGAGATGGGACACATCCAATATGACATGGCATATGCCAAGCAACCTTTCCTGCTAAGAAACGGAGCCAA
TGAAGGGTTCCATGAAGCCGTTGGAGAAATCATGTCACTTTCTGCAGCTACCCCCAAACATTTGAAATCT
ATTGGTCTTCTGCCATCCAATTTTCAAGAAGACAATGAAACAGAAATAAACTTCCTACTCAAACAGGCAT
TGACAATTGTTGGAACGCTGCCATTTACTTACATGTTAGAGAAGTGGAGGTGGATGGTCTTTCAGGATAA
AATTCCCAGAGAACAGTGGACCAAAAAGTGGTGGGAGATGAAGCGGGAGATCGTTGGTGTGGTGGAGCCT
CTGCCTCATGATGAAACATACTGTGACCCTGCATCTCTGTTCCATGTCTCTAATGATTACTCATTCATTC
GATATTACACAAGGACCATTTATCAATTCCAGTTTCAAGAAGCTCTTTGTCAAGCAGCTAAACATGATGG
CCCACTACACAAATGTGACATCTCAAATTCCACTGAAGCTGGGCAGAAGTTGCTCAATATGCTGAGTCTT
GGAAACTCAGGGCCCTGGACCCTAGCCTTGGAAAATGTGGTAGGATCAAGGAATATGGATGTAAAACCAC
TGCTCAATTACTTCCAACCATTGTTTGTCTGGCTGAAAGAGCAGAACAGGAATTCGACTGTGGGGTGGAG
CACTGACTGGAGCCCATATGCCGACCAAAGCATTAAAGTGAGGATAAGCCTAAAATCAGCTCTTGGGAAA
AATGCGTATGAATGGACCGACAACGAAATGTACCTATTCCGATCATCTGTTGCCTATGCCATGAGAGAGT
ATTTTTCAAGGGAAAAGAACCAGACAGTTCCTTTTGGGGAGGCAGACGTATGGGTGAGTGATTTGAAACC
AAGAGTCTCCTTCAACTTCTTTGTCACTTCACCCAAAAATGTGTCTGACATCATTCCCAGAAGTGAAGTT
GAAGAGGCCATCAGGATGTCTCGGGGCCGTATCAATGATATTTTTGGTCTGAATGATAACAGCCTGGAGT
TTCTGGGGATCTACCCAACACTTAAGCCACCTTACGAGCCTCCTGTCACCATATGGCTGATTATTTTTGG
TGTCGTGATGGGAACGGTAGTGGTTGGCATTGTTATCCTGATCGTCACTGGGATCAAAGGTCGAAAGAAG
AAAAATGAAACAAAAAGAGAAGAGAATCCTTATGACTCCATGGACATTGGCAAAGGAGAAAGTAACGCAG
GATTCCAAAACAGTGATGATGCTCAAACTTCATTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001012006
Insert Size 2418 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001012006.1, NP_001012006.1
RefSeq Size 2418 bp
RefSeq ORF 2418 bp
Locus ID 302668
UniProt ID Q5EGZ1
Cytogenetics Xq14
Gene Summary enzyme peptidyl-dipeptidase; mouse homolog has a role in regulation of cardiac contractility and regulating Angiotensin 1 and 2 levels [RGD, Feb 2006]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.