Artn (NM_053397) Rat Untagged Clone

CAT#: RN209126

Artn (untagged ORF) - Rat artemin (Artn), (10 ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Artn (NM_053397) Rat Untagged Clone
Symbol Artn
Vector pCMV6-Entry
Sequence Data
>RN209126 representing NM_053397
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACTGGGACTTGGAGAGCCTACTGCATTGTCCCACTGCCTCCGGCCTAGGTGGCAACCAGCCTTGT
GGCCAACCCTAGCTGCTCTAGCCCTGCTGAGCAGCGTCACAGAAGCTTCCCTGGACCCAATGTCCCGCAG
CCCCGCCTCTCGCGATGTTCCCTCGCCGGTCCTGGCGCCCCCAACAGACTACCTACCTGGGGGACACACC
GCACATCTGTGCAGCGAAAGAGCCCTGCGACCACCGCCGCAGTCTCCTCAGCCCGCACCCCCACCACCCG
GTCCCGCGCTCCAGTCTCCTCCCGCTGCGCTCCGCGGGGCACGCGCGGCGCGTGCAGGAACCCGGAGCAG
CCGCGCACGGGCTACAGATGCGCGCGGCTGCCGCCTGCGCTCACAGCTGGTGCCGGTGAGCGCTCTCGGC
CTGGGCCACAGCTCCGACGAGCTGATACGTTTCCGCTTCTGCAGCGGTTCGTGCCGCCGAGCACGCTCCC
CGCACGATCTCAGCCTGGCCAGCCTGCTGGACGCCGGGGCCCTGCGGTCGCCTCCCGGGTCCCGGCCGAT
CAGCCAGCCCTGTTGCCGGCCCACTCGCTATGAGGCCGTCTCCTTCATGGACGTGAACAGCACCTGGAGA
ACCGTGGACCATCTCTCCGCCACCGCCTGCGGCTGTCTGGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_053397
ORF Size 675 bp
Insert Size 675
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_053397.1, NP_445849
RefSeq Size 1357
RefSeq ORF 675
Locus ID 362572
Cytogenetics 5q36
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)