Artn (NM_053397) Rat Untagged Clone

CAT#: RN209126

Reviews ()
Write a review

Artn (untagged ORF) - Rat artemin (Artn), (10 ug)



  "NM_053397" in other vectors (5)

USD 420.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Artn (NM_053397) Rat Untagged Clone
Type Rat Untagged Clone
Tag Tag Free
Symbol Artn
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>RN209126 representing NM_053397
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACTGGGACTTGGAGAGCCTACTGCATTGTCCCACTGCCTCCGGCCTAGGTGGCAACCAGCCTTGT
GGCCAACCCTAGCTGCTCTAGCCCTGCTGAGCAGCGTCACAGAAGCTTCCCTGGACCCAATGTCCCGCAG
CCCCGCCTCTCGCGATGTTCCCTCGCCGGTCCTGGCGCCCCCAACAGACTACCTACCTGGGGGACACACC
GCACATCTGTGCAGCGAAAGAGCCCTGCGACCACCGCCGCAGTCTCCTCAGCCCGCACCCCCACCACCCG
GTCCCGCGCTCCAGTCTCCTCCCGCTGCGCTCCGCGGGGCACGCGCGGCGCGTGCAGGAACCCGGAGCAG
CCGCGCACGGGCTACAGATGCGCGCGGCTGCCGCCTGCGCTCACAGCTGGTGCCGGTGAGCGCTCTCGGC
CTGGGCCACAGCTCCGACGAGCTGATACGTTTCCGCTTCTGCAGCGGTTCGTGCCGCCGAGCACGCTCCC
CGCACGATCTCAGCCTGGCCAGCCTGCTGGACGCCGGGGCCCTGCGGTCGCCTCCCGGGTCCCGGCCGAT
CAGCCAGCCCTGTTGCCGGCCCACTCGCTATGAGGCCGTCTCCTTCATGGACGTGAACAGCACCTGGAGA
ACCGTGGACCATCTCTCCGCCACCGCCTGCGGCTGTCTGGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_053397
Insert Size 675 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_053397.1, NP_445849.1
RefSeq Size 1357 bp
RefSeq ORF 675 bp
Locus ID 362572
Cytogenetics 5q36

Citations (1)

Other Versions

Other products for "Artn"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools