Tuba1b (NM_001044270) Rat Untagged Clone

CAT#: RN205743

Tuba1b (untagged ORF) - Rat tubulin, alpha 1B (Tuba1b), (10 ug)

USD 577.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tuba1b (NM_001044270) Rat Untagged Clone
Symbol Tuba1b
Synonyms RGD1565476; RGD1565476
Vector pCMV6-Entry
Sequence Data
>RN205743 representing NM_001044270
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGTGAGTGCATCTCCATCCACGTCGGCCAGGCTGGTGTCCAGATCGGCAATGCCTGCTGGGAGCTCT
ACTGCCTGGAACATGGCATCCAGCCTGATGGCCAGATGCCAAGCGACAAGACCATTGGGGGAGGAGATGA
CTCCTTCAACACCTTCTTCAGTGAGACAGGAGCTGGCAAGCACGTGCCCCGGGCGGTGTTCGTAGACCTG
GAACCCACAGTTATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCAGAGCAGCTCATCA
CAGGCAAGGAAGATGCTGCCAATAACTATGCCCGTGGCCACTACACCATTGGCAAGGAGATCATTGACCT
TGTCTTGGACAGAATTCGCAAGCTGGCTGACCAGTGCACCGGTCTCCAGGGCTTCTTGGTTTTCCACAGC
TTTGGTGGGGGAACTGGCTCTGGGTTCACCTCCCTGCTGATGGAGAGGCTCTCTGTCGACTACGGAAAGA
AGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACTGCTGTGGTTGAGCCCTACAATTC
CATCCTCACCACCCACACCACCCTGGAGCACTCTGATTGTGCCTTCATGGTAGACAATGAGGCCATCTAT
GACATCTGTCGTAGAAACCTCGACATTGAGCGCCCAACCTACACTAACCTTAACCGCCTTATTAGCCAGA
TTGTGTCTTCCATCACTGCTTCCCTCAGATTTGATGGGGCCCTGAATGTTGATCTGACAGAATTCCAGAC
CAACCTGGTGCCCTACCCTCGCATCCACTTCCCTCTGGCCACTTATGCCCCTGTCATCTCTGCTGAGAAA
GCCTACCATGAACAGCTTTCTGTAGCAGAGATCACCAATGCCTGCTTTGAGCCAGCCAACCAGATGGTGA
AATGTGACCCTCGCCATGGTAAATACATGGCTTGCTGCCTGCTGTACCGTGGTGATGTGGTCCCCAAAGA
TGTCAATGCTGCCATTGCCACCATCAAGACCAAGCGCAGCATCCAGTTTGTGGACTGGTGCCCCACTGGC
TTCAAGGTTGGCATTAATTACCAGCCTCCCACTGTGGTACCTGGTGGCGACCTGGCCAAGGTCCAGAGAG
CTGTGTGTATGCTGAGCAACACCACAGCCATTGCTGAGGCTTGGGCTCGCCTGGATCACAAGTTTGATCT
GATGTATGCCAAGCGTGCCTTTGTGCACTGGTACGTGGGTGAGGGCATGGAGGAGGGAGAGTTCTCTGAG
GCCCGTGAGGACATGGCTGCCCTAGAGAAGGATTATGAGGAGGTTGGTGTGGATTCTGTGGAGGGTGAGG
GTGAGGAAGAAGGAGAGGAATACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001044270
ORF Size 1356 bp
Insert Size 1356
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001044270.2, NP_001037735
RefSeq Size 1645
RefSeq ORF 1356
Locus ID 500929
Cytogenetics 7q36
Gene Summary Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.