Celf1 (NM_001025421) Rat Untagged Clone

SKU
RN204942
Celf1 (untagged ORF) - Rat CUG triplet repeat, RNA binding protein 1 (Cugbp1), (10 ug)
$503.00
5 Weeks*
Specifications
Product Data
Type Rat Untagged Clone
Target Symbol Celf1
Synonyms Cugbp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>RN204942 representing NM_001025421
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACGGCACCCTGGACCACCCAGACCAACCAGATCTTGATGCTATCAAGATGTTTGTGGGCCAGGTTC
CAAGGACCTGGTCGGAGAAAGACTTGAGGGAGCTTTTTGAGCAGTATGGTGCTGTCTATGAAATCAACAT
CCTAAGGGATAGGAGCCAAAACCCTCCTCAGAGCAAAGGGTGCTGTTTTGTTACATTTTACACCCGTAAA
GCTGCATTAGAAGCTCAGAATGCTCTCCACAACATGAAGGTTCTACCTGGGATGCATCACCCTATACAGA
TGAAACCCGCGGACAGTGAGAAGAACAACGCTGTGGAAGACAGGAAGCTGTTTATTGGTATGATTTCCAA
GAAGTGTACTGAAAATGACATCCGAGTCATGTTTTCTTCGTTTGGACAGATTGAAGAGTGCCGGATATTG
CGGGGACCTGATGGCTTGAGCAGAGGTTGTGCATTTGTGACTTTTACAACAAGAACCATGGCACAGACAG
CTATCAAAGCAATGCACCAAGCACAGACCATGGAGGGTTGCTCATCCCCCATGGTGGTAAAGTTTGCTGA
CACCCAGAAGGACAAAGAACAGAAGAGAATGGCCCAGCAGCTCCAGCAGCAGATGCAGCAGATTAGTGCA
GCGTCTGTGTGGGGGAACCTGGCTGGTCTGAACACACTTGGGCCCCAGTACTTAGCACTTTATTTGCAGC
TCCTTCAGCAGACTGCCAACTCTGGGAACCTCAACACCCTGAGCAGCCTCCACCCAATGGGAGGGTTAAA
TGCAATGCAGCTCCAGAATTTGGCTGCACTGGCTGCTGCAGCTAGTGCAGCTCAGAATACACCAAGTGGT
ACCAATGCTCTCACTACATCCAGCAGTCCCCTCAGCGTACTCACCAGTTCAGCAGGGTCTTCACCGAGCT
CCAGCAGCAGTAATTCTGTCAACCCCATAGCCTCACTTGGAGCGCTGCAAACATTAGCCGGAGCAACAGC
TGGCCTCAACGTTGGCTCATTGGCAGGAATGGCTGCTTTGAATGGAGGTTTGGGCAGCAGTGGCCTTTCC
AATGGCACTGGGAGTACCATGGAAGCCCTCACCCAGGCGTATTCTGGTATCCAGCAATATGCTGCTGCAG
CCCTCCCTACTCTGTACAACCAGAATCTGTTGACACAGCAGAGTATTGGTGCTGCTGGAAGCCAGAAGGA
AGGTCCAGAAGGAGCCAACCTGTTCATCTATCACCTGCCCCAAGAGTTTGGAGACCAGGACTTACTGCAG
ATGTTTATGCCCTTTGGGAATGTCGTGTCTGCCAAGGTTTTCATAGACAAGCAGACCAACCTGAGCAAGT
GTTTTGGTTTTGTAAGTTATGACAATCCTGTCTCAGCTCAAGCTGCCATCCAGTCCATGAACGGCTTTCA
AATTGGAATGAAGAGGCTTAAAGTGCAGCTCAAACGTTCGAAGAATGATAGTAAGCCCTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_001025421
Insert Size 1464 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001025421.1, NP_001020592.1
RefSeq Size 2044 bp
RefSeq ORF 1464 bp
Locus ID 362160
UniProt ID Q4QQT3
Cytogenetics 3q24
Summary RNA-binding protein implicated in the regulation of several post-transcriptional events. Involved in pre-mRNA alternative splicing, mRNA translation and stability. Mediates exon inclusion and/or exclusion in pre-mRNA that are subject to tissue-specific and developmentally regulated alternative splicing. Specifically activates exon 5 inclusion of cardiac isoforms of TNNT2 during heart remodeling at the juvenile to adult transition. Acts as both an activator and repressor of a pair of coregulated exons: promotes inclusion of the smooth muscle (SM) exon but exclusion of the non-muscle (NM) exon in actinin pre-mRNAs. Activates SM exon 5 inclusion by antagonizing the repressive effect of PTB. Promotes exclusion of exon 11 of the INSR pre-mRNA. Inhibits, together with HNRNPH1, insulin receptor (IR) pre-mRNA exon 11 inclusion in myoblast. Increases translation and controls the choice of translation initiation codon of CEBPB mRNA. Increases mRNA translation of CEBPB in aging liver. Increases translation of CDKN1A mRNA by antagonizing the repressive effect of CALR3. Mediates rapid cytoplasmic mRNA deadenylation. Recruits the deadenylase PARN to the poly(A) tail of EDEN-containing mRNAs to promote their deadenylation. Required for completion of spermatogenesis. Binds to (CUG)n triplet repeats in the 3' UTR of transcripts such as DMPK and to Bruno response elements (BREs). Binds to muscle-specific splicing enhancer (MSE) intronic sites flanking the alternative exon 5 of TNNT2 pre-mRNA. Binds to AU-rich sequences (AREs or EDEN-like) localized in the 3' UTR of JUN and FOS mRNAs. Binds to the IR RNA. Binds to the 5'-region of CDKN1A and CEBPB mRNAs. Binds with the 5'-region of CEBPB mRNA in aging liver (By similarity). May be a specific regulator of miRNA biogenesis. Binds to primary microRNA pri-MIR140 and, with CELF2, negatively regulates the processing to mature miRNA (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Celf1 (NM_001025421) Rat Untagged Clone
Your Rating
SKU Description Size Price
RR204942 Celf1 (Myc-DDK-tagged ORF) - Rat CUG triplet repeat, RNA binding protein 1 (Cugbp1), (10 ug) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RR204942L3 Lenti ORF clone of Celf1 (Myc-DDK-tagged ORF) - Rat CUG triplet repeat, RNA binding protein 1 (Cugbp1), (10 ug) 10 ug
$757.00
RR204942L4 Lenti ORF clone of Celf1 (mGFP-tagged ORF) - Rat CUG triplet repeat, RNA binding protein 1 (Cugbp1), (10 ug) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.