Celf1 (NM_001025421) Rat Untagged Clone

CAT#: RN204942

Celf1 (untagged ORF) - Rat CUG triplet repeat, RNA binding protein 1 (Cugbp1), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Celf1
• Synonyms: Cugbp1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN204942 representing NM_001025421
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAACGGCACCCTGGACCACCCAGACCAACCAGATCTTGATGCTATCAAGATGTTTGTGGGCCAGGTTC
  CAAGGACCTGGTCGGAGAAAGACTTGAGGGAGCTTTTTGAGCAGTATGGTGCTGTCTATGAAATCAACAT
  CCTAAGGGATAGGAGCCAAAACCCTCCTCAGAGCAAAGGGTGCTGTTTTGTTACATTTTACACCCGTAAA
  GCTGCATTAGAAGCTCAGAATGCTCTCCACAACATGAAGGTTCTACCTGGGATGCATCACCCTATACAGA
  TGAAACCCGCGGACAGTGAGAAGAACAACGCTGTGGAAGACAGGAAGCTGTTTATTGGTATGATTTCCAA
  GAAGTGTACTGAAAATGACATCCGAGTCATGTTTTCTTCGTTTGGACAGATTGAAGAGTGCCGGATATTG
  CGGGGACCTGATGGCTTGAGCAGAGGTTGTGCATTTGTGACTTTTACAACAAGAACCATGGCACAGACAG
  CTATCAAAGCAATGCACCAAGCACAGACCATGGAGGGTTGCTCATCCCCCATGGTGGTAAAGTTTGCTGA
  CACCCAGAAGGACAAAGAACAGAAGAGAATGGCCCAGCAGCTCCAGCAGCAGATGCAGCAGATTAGTGCA
  GCGTCTGTGTGGGGGAACCTGGCTGGTCTGAACACACTTGGGCCCCAGTACTTAGCACTTTATTTGCAGC
  TCCTTCAGCAGACTGCCAACTCTGGGAACCTCAACACCCTGAGCAGCCTCCACCCAATGGGAGGGTTAAA
  TGCAATGCAGCTCCAGAATTTGGCTGCACTGGCTGCTGCAGCTAGTGCAGCTCAGAATACACCAAGTGGT
  ACCAATGCTCTCACTACATCCAGCAGTCCCCTCAGCGTACTCACCAGTTCAGCAGGGTCTTCACCGAGCT
  CCAGCAGCAGTAATTCTGTCAACCCCATAGCCTCACTTGGAGCGCTGCAAACATTAGCCGGAGCAACAGC
  TGGCCTCAACGTTGGCTCATTGGCAGGAATGGCTGCTTTGAATGGAGGTTTGGGCAGCAGTGGCCTTTCC
  AATGGCACTGGGAGTACCATGGAAGCCCTCACCCAGGCGTATTCTGGTATCCAGCAATATGCTGCTGCAG
  CCCTCCCTACTCTGTACAACCAGAATCTGTTGACACAGCAGAGTATTGGTGCTGCTGGAAGCCAGAAGGA
  AGGTCCAGAAGGAGCCAACCTGTTCATCTATCACCTGCCCCAAGAGTTTGGAGACCAGGACTTACTGCAG
  ATGTTTATGCCCTTTGGGAATGTCGTGTCTGCCAAGGTTTTCATAGACAAGCAGACCAACCTGAGCAAGT
  GTTTTGGTTTTGTAAGTTATGACAATCCTGTCTCAGCTCAAGCTGCCATCCAGTCCATGAACGGCTTTCA
  AATTGGAATGAAGAGGCTTAAAGTGCAGCTCAAACGTTCGAAGAATGATAGTAAGCCCTACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001025421
• Insert Size: 1464 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001025421.1, NP_001020592.1
• RefSeq Size: 2044 bp
• RefSeq ORF: 1464 bp
• Locus ID: 362160
• UniProt ID: Q4QQT3
• Cytogenetics: 3q24
• Gene Summary: RNA-binding protein implicated in the regulation of several post-transcriptional events. Involved in pre-mRNA alternative splicing, mRNA translation and stability. Mediates exon inclusion and/or exclusion in pre-mRNA that are subject to tissue-specific and developmentally regulated alternative splicing. Specifically activates exon 5 inclusion of cardiac isoforms of TNNT2 during heart remodeling at the juvenile to adult transition. Acts as both an activator and repressor of a pair of coregulated exons: promotes inclusion of the smooth muscle (SM) exon but exclusion of the non-muscle (NM) exon in actinin pre-mRNAs. Activates SM exon 5 inclusion by antagonizing the repressive effect of PTB. Promotes exclusion of exon 11 of the INSR pre-mRNA. Inhibits, together with HNRNPH1, insulin receptor (IR) pre-mRNA exon 11 inclusion in myoblast. Increases translation and controls the choice of translation initiation codon of CEBPB mRNA. Increases mRNA translation of CEBPB in aging liver. Increases translation of CDKN1A mRNA by antagonizing the repressive effect of CALR3. Mediates rapid cytoplasmic mRNA deadenylation. Recruits the deadenylase PARN to the poly(A) tail of EDEN-containing mRNAs to promote their deadenylation. Required for completion of spermatogenesis. Binds to (CUG)n triplet repeats in the 3' UTR of transcripts such as DMPK and to Bruno response elements (BREs). Binds to muscle-specific splicing enhancer (MSE) intronic sites flanking the alternative exon 5 of TNNT2 pre-mRNA. Binds to AU-rich sequences (AREs or EDEN-like) localized in the 3' UTR of JUN and FOS mRNAs. Binds to the IR RNA. Binds to the 5'-region of CDKN1A and CEBPB mRNAs. Binds with the 5'-region of CEBPB mRNA in aging liver (By similarity). May be a specific regulator of miRNA biogenesis. Binds to primary microRNA pri-MIR140 and, with CELF2, negatively regulates the processing to mature miRNA (By similarity).[UniProtKB/Swiss-Prot Function]