Abca5 (NM_173307) Rat Untagged Clone

CAT#: RN203757

Abca5 (untagged ORF) - Rat ATP-binding cassette, sub-family A (ABC1), member 5 (Abca5), (10 ug)

USD 2,617


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Abca5 (NM_173307) Rat Untagged Clone
Symbol Abca5
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>RN203757 representing NM_173307
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTACTGCAATTAGGGATGTGGGCGTTTGGAGACAGACCAGAACACTTCTTCTGAAGAATTACCTCG
TCAAATGCAGGACTAAAAAGAGTAGTGTTCAGGAAATTCTTTTTCCTCTATTTTTCTTATTTTGGCTGAT
ATTAATTAGCATGATGCATCCAAATAAGAAATATGAAGAAGTATCTGATATAGAACTCAGCCCTATGGAC
AAATCCATCCTTTCCAACCTTATCCTGGGGTACACTCCAGTGACTAATACTACAAGCAGCGTCATGCAGA
GAGTTTCTACCGATCATCTTCCCGACGTTCTAGTTACTGAAGAATACGCCAGTGAGAAGGAGCTGCTGGC
ATCCAGTTTGTCTAAGCCCAGCAACTTCGTGGGTGTGGTTTTCAAAGACGTCATGTCCTATGAACTGCGG
TTTTTTCCTGATATGGTTCCAGTGTCTTCTGTTTATATGGATTCAAGAGCAGGCTGTTCAAAGTCATGTG
ATGCTGCTCAGTACTGGTCTTCAGGGTTTACAGCTTTACAGGCCTCAATAGATGCTGCCATTATACAGTT
GAAGACCAATGTTTCTCTGTGGAGGGAGCTGGAGTCAACCAAAGCTGTCATCATGGGGGAAGCTGCGGTC
GTGGAGATTGACACCTTCCCACGAGGGGTCATCCTCATCTACCTCGTCATAGCCTTCTCGCCCTTCGGGT
ACTTTCTGGCAATTCACATTGTAGCAGAAAAGGAAAAGAGGTTAAAGGAGTTTTTAAAGATAATGGGACT
TCACGACACTGCTTTTTGGCTGTCCTGGGTTCTTCTGTACACGAGTTTGATCTTCCTTATGTCCCTTCTT
ATGGCCGTCATTGCAACAGCGTCCTCGTTATTCCCTCAGAGTAGCAGCATCGTGATTTTTCTGCTCTTCT
TCCTGTACGGATTGTCATCTGTGTTTTTTGCTTTAATGTTGACGCCTCTTTTTAAAAAATCAAAGCACGT
GGGAGTCGTTGAGTTTTTTGTCACCGTGGTGTTTGGCTTTGTCGGCCTGTTGATAGTCCTCGTAGAAAGT
TTCCCCAGGTCGCTAGTGTGGCTCTTCAGTCCTTTGTGTCAGTGCGCCTTTCTGATTGGGATTGCACAGG
TCATGCATTTAGAAGATTTCAATGAAGGAGCCTTATTTTCTAGTTTGACTGAAGGCCCCTACCCGCTAAT
TATCACCCTTACCATGCTCGCTCTGGACAGTGTGTTCTATGCCCTGCTGGCTGTGTACCTTGATCAGGTC
ATCCCAGGGGAATTTGGCTTGAGGAGGTCATCTTTGTACTTCCTAAAGCCATCATATTGGTCAAAAAACA
AAAGGAACTATAAGGAGCTATCAGAGGGCAACATCAATGGGAATATTAGTCTCAATGAAATTGTTGAGCC
CGTTTCTTCAGAATTTATAGGAAAAGAAGCTATAAGAATAAGTGGTATTCAGAAAGCCTATAGGAAGAAG
AATGAGACCGTGGAGGCTTTGAGAAATTTGTCGTTTGACATCTATGAAGGCCAGATTACTGCTCTGCTGG
GCCACAGTGGAACAGGAAAAAGCACACTAATGAATATTCTGTGTGGACTGTGCCCACCTTCTGATGGGTT
TGCTTCTATATATGGACACAGAGTCTCTGAAATAGATGAAATGTTTGAAGCGAGGAAAATGATTGGCATA
TGTCCACAGTCAGATATGAACTTTGATGTTCTGACAGTAGAAGAAAATTTATCAATTTTGGCTTCAGTCA
AAGGAATACCAGCCAACAACATAATTCAGGAAGTACAGAAAGTTTTACTGGATTTGGACATGCAAGCCAT
CAAAGATAATCAAGCGAAAAAACTAAGTGGTGGCCAAAAGAGAAAGCTGTCTTTAGGAATTGCAGTTCTT
GGGAATCCAAAGATCCTCCTGCTAGATGAGCCGACAGCAGGAATGGACCCCTGCTCTCGCCACATTGTTT
GGAATCTTCTCAAGTACAGGAAGGCTAACCGAGTGACAGTCTTCAGCACTCACTTCATGGATGAGGCCGA
CATTCTTGCCGACAGGAAAGCTGTCATATCACAAGGAATGCTGAAATGTGTTGGTTCTTCAATTTTCCTG
AAAAGTAAATGGGGAATCGGCTACCGTCTGAGCATGTATATAGACAGGTACTGTGCCACAGAGTCGCTCT
CGTCGCTGGTTAGACAGCACATCCCTGCGGCCGCTCTGCTGCAGCAGAATGACCAGCAGATTGTCTATAG
CTTGCCCTTCAAAGACATGGACAAATTTTCAGGCTTGTTTTCTGCTCTAGACATTCATTCAAACCTGGGT
GTAATTTCTTATGGTGTTTCCATGACGACATTGGAAGACGTGTTTTTAAAGCTAGAAGTTGAAGCAGAAA
TTGACCAAGCAGATTATAGTGTATTTACCCAGCAGCCACGGGAGGAAGAAACAGATTCAAAGTCTTTTGA
TGAAATGGAACAGAGTTTACTTATTCTCTCTGAAACCAAAGCTTCTCTAGTGAGCACCATGAGTCTCTGG
AAGCAGCAAGTATCTACAATAGCAAAGTTTCATTTCCTCTCACTGAAGCGAGAAAGCAAATCAGTGCGCT
CTGTGTTGCTTCTGCTTTTAATTTTTTTTGCAGTTCAGATTTTTATGTTTTTGGTCCATCATTCTTTTAA
AAATGCTGTGGTTCCCATCAAGCTCGTTCCAGACTTGTATTTTCTAAAACCTGGAGATAAACCTCATAAA
TACAAAACAAGCCTGCTGCTTCAAAATTCTACTGATTCAGATATCAATGATCTTATTGACTTTTTCACAC
AGCAGAACATAATTGTGGCCATGTTTAATGACAGTGACTATGTGTCTGCTGCTCCTCATAGTGCGGCTCT
CAATGTGGTGCAGTCAGAAAAGGACTATGTTTTTACTGCTGTTTTCAACAGTACTATGGTTTATTCTTTG
CCAGTAATGATGAACATCATTAGTAACTACTATCTCTATCATTTAAATGTGACTGACACTATCCAGATCT
GGAGTACCCCGTTCATTCAGGAAATTACTGACATTGTTTTTAAAGTTGAGCTATATTTTCAAGCAGCTTT
GCTTGGAATCATTGTTACTGCAATGCCACCTTACTTTGCCATGGAAAATGCAGAGAATCATAAGATCAAA
GCTTACACTCAGCTTAAACTTTCAGGTCTTTTGCCATCCGCCTACTGGATTGGACAGGCTGTGGTGGACA
TTCCCCTGTTTTTTGTTGTTCTGACTTTGATGCTGGGAAGTTTATTTGCCTTTCATCACGGACTGTATTT
TTATCCTGTAAAGTTTCTTGCTGTGGTTTTTTGCCTCATTGCTTATGTGCCCTCGGTTATTCTGTTCACT
TATATAGCTTCGTTCACCTTTAAGAAAATTTTAAATACCAAGGAATTTTGGTCATTTATCTATTCTGTGA
CAGCATTGGCTTGTGTCGCAGTCACGGAAATAACTTTCTTTCTGGGGTATGGAGTTACGGCTGTTTTTCA
TTACACCTTCTGCATAGCCATCCCAATCTACCCGCTCCTGGGTTGTCTGATTTCTTTCATAAAGGGTTCT
TGGAAGAATATACCAAAAACTGAGAATGCCTACAATCCCTGGGACAGACTTTTAGTTGCTGTAATCATGC
CCTACCTGCAGTGTGTACTGTGGATTTTCCTCTTACAACACTATGAGAAAAAACATGGAGGCAGATCAAT
AAGAAAGGATCCGCTTTTCAGGGCCCTCTCACAAAAAGCCAAACATAAGAAGTTTCCAGAACCACCCATC
AATGAGGATGAAGATGAAGATGTCAAAGCGGAAAGGTTGAAGGTTAAAGAGCTGATGGGTTGCCAGTGTT
GTGAGGAGAAACCGGCCATTATGGTATACAATTTGCATAAAGAATATGATGACAAGAAAGATTTCCTTCA
CTCAAGGAAAACAACAAAAGTAGCAACAAAATACGTCTCTTTCTGTGTGAAAAAAGGAGAGATCTTGGGA
CTGTTGGGTCCAAATGGTGCTGGCAAAAGCACGATTATTAATATTCTTGTTGGGGATGTTGAACCAACTT
CAGGCAAGATATTTCTAGGAGATTATGGTTCACATTCAAATGAAGATGATGAATCCACCAAGTGTATGGG
TTACTGCCCCCAGACAAACCCACTCTGGCCAGATATTACTCTGCAAGAACATTTTGAAATTTATGGAGCT
GTGAAAGGGATGAGTTCAGGTGACATGAAGGAAGTAATCAGTCGAATAACAAAAGCCCTTGATTTGAAAG
AACATCTTCAGAAAACTGTAAAGAAACTCCCTGCAGGGATCAAGCGAAAGCTGTGTTTTGCTCTCAGTAT
GCTGGGGAATCCTCAGGTGACACTGCTGGATGAGCCGTCTACAGGTATGGACCCCAGAGCCAAACAGCAC
ATGTGGCGAGCCATTCGAACTGCGTTTAAAAACAAGAAGCGGGCTGCCCTCCTCACTACGCATTACATGG
AAGAGGCGGAGGCTGTCTGTGACAGGGTGGCCATCATGGTGTCCGGGCAGCTAAGATGCATTGGAACAGT
ACAACATCTAAAGAGCAAGTTTGGCAAAGGCTACTTTTTAGAAATTAAACTAAAGGACTGGATAGAAAAC
CTGGAAATAGATCGCCTTCAAAGAGAAATTCAATATATTTTCCCAAATGCAAGCCGCCAAGAGAGCTTCT
CTTCTATTCTGGCTTATAAAATTCCAAAAGAAGATGTCCAGTCTCTCTCACAGTCCTTTGCTAAGTTGGA
GGAAGCAAAACACACTTTTGCCATTGAAGAATACAGCTTTTCTCAAGCAACCCTGGAACAGGTTTTTGTA
GAACTTACTAAGGAGCAGGAGGAGGAAGATAATAGCTGCGGGACTTTAAACAGCACGCTCTGGTGGGAAA
GAAGGCAGGAAGACAGAGTCGTGTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_173307
ORF Size 4929 bp
Insert Size 4929
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_173307.1, NP_775429
RefSeq Size 5170
RefSeq ORF 4929
Locus ID 286970
Cytogenetics 10q32.1
Gene Summary ATP-binding cassette (ABC) transporter [RGD, Feb 2006].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.