Nhej1 (NM_001014217) Rat Untagged Clone

CAT#: RN202174

Nhej1 (untagged ORF) - Rat nonhomologous end-joining factor 1 (Nhej1), (10 ug)



  "NM_001014217" in other vectors (3)

Reconstitution Protocol

USD 330.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "Nhej1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Nhej1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202174 representing NM_001014217
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGAACTAGAGCAAGGCCTGTTGATGCAGCCATGGGCATGGTTACAACTTGCTGAGAACTCACTCT
TGGCCAAGGCTTCTATCACCAAGCATGGTTATGCCTTGCTGATTTCGGATCTTCAACAGGTGTGGCATGA
ACAGGTGGACACTTTGGAGGTCAGCCAGCGAGCCAAGGAGCTGAACAAGCGCCTCACCGCTCCCCCTGCA
GCTTTTCTCCATCACTTGGATGAAGTGCTTCGCCCACTGTTTAAAGATTCTGCCCACCAGGATGCTGCTC
ACCCTAGCAAAGCCACTTTCTCCTGTGATCGTGGAGAGGAGGTATTGATCCTGAGGGTGCGGAGTGAGCT
CTCTGGTCTCCCCTTCAATTGGCATTTCCACTGTCTTCCAGCTAGTTCTTTACTGGTCTCTCAGCATTTG
ATTTGTCCTCTGATGGGTGTGAGCTTGGCATTGCACAGTCATGTGAGGGAGCTAGCAGCATTGCTTCGGA
TGAAGGACCTTGAGATCCAGGCCTACCAGGAGAGTGGGGCTGTGCTGAGCCGAGGTCGATTGAAGACAGA
GCCATTTGAAGAAAATTCTTTCTTGGAACAGTTTATGGTAGAGAAATTGCCAGAGGCATGTGCTGTTGGT
GATGGAAGGCCATTTGCCATGAATCTGCAGAGCCTGTATGTGGCAGTCACAAAGCAGCAGGTCCAAGCCA
GGCAGAAGCATAAAGGCTCTGGAGAGCCTCAGACATCAAGCAGCACCTCCCCTCAAGGAACTGATAGCCA
GCTTCAGAACCAGCCAGAACAGCAGATCTCTCCCACTCCAACCCTCTCAGAGCCTGAATGTGAGCCTATG
GCTGCTTCAGGCCCTGTGCATAGAGCTCAGCTGGTAAAGGCCAAGAGGAAGAAGCCCAGGGGACTCTTCA
GTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001014217
Insert Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001014217.1, NP_001014239.1
RefSeq Size 1445 bp
RefSeq ORF 915 bp
Locus ID 363251
UniProt ID Q6AYI4
Cytogenetics 9q33
Gene Summary DNA repair protein involved in DNA nonhomologous end joining (NHEJ) required for double-strand break (DSB) repair and V(D)J recombination. May serve as a bridge between XRCC4 and the other NHEJ factors located at DNA ends, or may participate in reconfiguration of the end bound NHEJ factors to allow XRCC4 access to the DNA termini. It may act in concert with XRCC6/XRCC5 (Ku) to stimulate XRCC4-mediated joining of blunt ends and several types of mismatched ends that are noncomplementary or partially complementary. Binds DNA in a length-dependent manner.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s)

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.