Cebpb (NM_009883) Mouse Tagged ORF Clone
CAT#: MR227563
- TrueORF®
Cebpb (Myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb)
ORF Plasmid: tGFP
Lentiviral Particles: DDK DDK w/ Puro mGFP mGFP w/ Puro
AAV Particle: DDK
"NM_009883" in other vectors (6)
Interest in protein/lysate? Submit request here!
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Symbol | Cebpb |
Synonyms | C/EBPbeta; CRP2; IL-6DBP; LAP; LIP; NF-IL6; NF-M; Nfil6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR227563 representing NM_009883
Red=Cloning site Blue=ORF Green=Tags(s) CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCACCGCCTGCTGGCCTGGGACGCAGCATGCCTCCCGCCGCCGCCCGCCGCCTTTAGACCCATGGAAG TGGCCAACTTCTACTACGAGCCCGACTGCCTGGCCTACGGGGCCAAGGCGGCCCGCGCCGCGCCGCGCGC CCCCGCCGCCGAGCCGGCCATTGGCGAGCACGAGCGCGCCATCGACTTCAGCCCCTACCTGGAGCCGCTC GCGCCCGCCGCGGACTTCGCCGCGCCCGCGCCCGCGCACCACGACTTCCTCTCCGACCTCTTCGCCGACG ACTACGGCGCCAAGCCGAGCAAGAAGCCGGCCGACTACGGTTACGTGAGCCTCGGCCGCGCGGGCGCCAA GGCCGCGCCGCCCGCCTGCTTCCCGCCGCCGCCTCCCGCCGCGCTCAAGGCGGAGCCGGGCTTCGAACCC GCGGACTGCAAGCGCGCGGACGACGCGCCCGCCATGGCGGCCGGTTTCCCGTTCGCCCTGCGCGCCTACC TGGGCTACCAGGCGACGCCGAGCGGCAGCAGCGGCAGCCTGTCCACGTCGTCGTCGTCCAGCCCGCCCGG CACGCCGAGCCCCGCCGACGCCAAGGCCGCGCCCGCCGCCTGCTTCGCGGGGCCGCCGGCCGCGCCCGCC AAGGCCAAGGCCAAGAAGACGGTGGACAAGCTGAGCGACGAGTACAAGATGCGGCGCGAGCGCAACAACA TCGCGGTGCGCAAGAGCCGCGACAAGGCCAAGATGCGCAACCTGGAGACGCAGCACAAGGTGCTGGAGCT GACGGCGGAGAACGAGCGGCTGCAGAAGAAGGTGGAGCAGCTGTCGCGAGAGCTCAGCACCCTGCGGAAC TTGTTCAAGCAGCTGCCCGAGCCGCTGCTGGCCTCGGCGGGCCACTGC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites |
SgfI-MluI
Cloning Scheme for this gene
Plasmid Map
![]() |
ACCN | NM_009883 |
ORF Size | 888 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_009883.4 |
RefSeq Size | 1507 bp |
RefSeq ORF | 891 bp |
Locus ID | 12608 |
UniProt ID | P28033 |
Cytogenetics | 2 87.58 cM |
MW | 31.9 kDa |
Gene Summary | Important transcription factor regulating the expression of genes involved in immune and inflammatory responses (PubMed:16585579, PubMed:17911624, PubMed:18486321, PubMed:20111005). Plays also a significant role in adipogenesis, as well as in the gluconeogenic pathway, liver regeneration, and hematopoiesis (PubMed:9727068, PubMed:10635333, PubMed:17301242, PubMed:17601773, PubMed:19478079, PubMed:24061474, PubMed:24216764). The consensus recognition site is 5'-T[TG]NNGNAA[TG]-3'. Its functional capacity is governed by protein interactions and post-translational protein modifications. During early embryogenesis, plays essential and redundant functions with CEBPA (PubMed:15509779). Has a promitotic effect on many cell types such as hepatocytes and adipocytes but has an antiproliferative effect on T-cells by repressing MYC expression, facilitating differentiation along the T-helper 2 lineage (PubMed:9727068, PubMed:10635333, PubMed:16585579). Binds to regulatory regions of several acute-phase and cytokines genes and plays a role in the regulation of acute-phase reaction and inflammation. Plays also a role in intracellular bacteria killing (PubMed:17911624). During adipogenesis, is rapidly expressed and, after activation by phosphorylation, induces CEBPA and PPARG, which turn on the series of adipocyte genes that give rise to the adipocyte phenotype. The delayed transactivation of the CEBPA and PPARG genes by CEBPB appears necessary to allow mitotic clonal expansion and thereby progression of terminal differentiation (PubMed:15985551, PubMed:17301242, PubMed:17601773, PubMed:20194620). Essential for female reproduction because of a critical role in ovarian follicle development (PubMed:9303532). Restricts osteoclastogenesis (PubMed:19440205). Together with NFE2L1; represses expression of DSPP during odontoblast differentiation (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC208276 | Cebpb (untagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb), (10ug) |
USD 300.00 |
|
MG227563 | Cebpb (tGFP-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP) beta (Cebpb), (10ug) |
USD 500.00 |
|
MR227563L1 | Lenti ORF clone of Cebpb (Myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb) |
USD 600.00 |
|
MR227563L2 | Lenti ORF clone of Cebpb (mGFP-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb) |
USD 600.00 |
|
MR227563L3 | Lenti ORF clone of Cebpb (Myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb) |
USD 600.00 |
|
MR227563L4 | Lenti ORF clone of Cebpb (mGFP-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review