Cebpb (NM_009883) Mouse Tagged ORF Clone

CAT#: MR227563

Cebpb (Myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb)

Product Images

Circular map for MR227563

Specifications

Product Data

• Type: Mouse Tagged ORF Clone
• Tag: Myc-DDK
• Symbol: Cebpb
• Synonyms: C/EBPbeta; CRP2; IL-6DBP; LAP; LIP; NF-IL6; NF-M; Nfil6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  ORF Nucleotide Sequence

  >MR227563 representing NM_009883
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCACCGCCTGCTGGCCTGGGACGCAGCATGCCTCCCGCCGCCGCCCGCCGCCTTTAGACCCATGGAAG
  TGGCCAACTTCTACTACGAGCCCGACTGCCTGGCCTACGGGGCCAAGGCGGCCCGCGCCGCGCCGCGCGC
  CCCCGCCGCCGAGCCGGCCATTGGCGAGCACGAGCGCGCCATCGACTTCAGCCCCTACCTGGAGCCGCTC
  GCGCCCGCCGCGGACTTCGCCGCGCCCGCGCCCGCGCACCACGACTTCCTCTCCGACCTCTTCGCCGACG
  ACTACGGCGCCAAGCCGAGCAAGAAGCCGGCCGACTACGGTTACGTGAGCCTCGGCCGCGCGGGCGCCAA
  GGCCGCGCCGCCCGCCTGCTTCCCGCCGCCGCCTCCCGCCGCGCTCAAGGCGGAGCCGGGCTTCGAACCC
  GCGGACTGCAAGCGCGCGGACGACGCGCCCGCCATGGCGGCCGGTTTCCCGTTCGCCCTGCGCGCCTACC
  TGGGCTACCAGGCGACGCCGAGCGGCAGCAGCGGCAGCCTGTCCACGTCGTCGTCGTCCAGCCCGCCCGG
  CACGCCGAGCCCCGCCGACGCCAAGGCCGCGCCCGCCGCCTGCTTCGCGGGGCCGCCGGCCGCGCCCGCC
  AAGGCCAAGGCCAAGAAGACGGTGGACAAGCTGAGCGACGAGTACAAGATGCGGCGCGAGCGCAACAACA
  TCGCGGTGCGCAAGAGCCGCGACAAGGCCAAGATGCGCAACCTGGAGACGCAGCACAAGGTGCTGGAGCT
  GACGGCGGAGAACGAGCGGCTGCAGAAGAAGGTGGAGCAGCTGTCGCGAGAGCTCAGCACCCTGCGGAAC
  TTGTTCAAGCAGCTGCCCGAGCCGCTGCTGGCCTCGGCGGGCCACTGC
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI Cloning Scheme for this gene Plasmid Map
• ACCN: NM_009883
• ORF Size: 888 bp
• OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.

Reference Data

• RefSeq: NM_009883.4
• RefSeq Size: 1507 bp
• RefSeq ORF: 891 bp
• Locus ID: 12608
• UniProt ID: P28033
• Cytogenetics: 2 87.58 cM
• MW: 31.9 kDa
• Gene Summary: Important transcription factor regulating the expression of genes involved in immune and inflammatory responses (PubMed:16585579, PubMed:17911624, PubMed:18486321, PubMed:20111005). Plays also a significant role in adipogenesis, as well as in the gluconeogenic pathway, liver regeneration, and hematopoiesis (PubMed:9727068, PubMed:10635333, PubMed:17301242, PubMed:17601773, PubMed:19478079, PubMed:24061474, PubMed:24216764). The consensus recognition site is 5'-T[TG]NNGNAA[TG]-3'. Its functional capacity is governed by protein interactions and post-translational protein modifications. During early embryogenesis, plays essential and redundant functions with CEBPA (PubMed:15509779). Has a promitotic effect on many cell types such as hepatocytes and adipocytes but has an antiproliferative effect on T-cells by repressing MYC expression, facilitating differentiation along the T-helper 2 lineage (PubMed:9727068, PubMed:10635333, PubMed:16585579). Binds to regulatory regions of several acute-phase and cytokines genes and plays a role in the regulation of acute-phase reaction and inflammation. Plays also a role in intracellular bacteria killing (PubMed:17911624). During adipogenesis, is rapidly expressed and, after activation by phosphorylation, induces CEBPA and PPARG, which turn on the series of adipocyte genes that give rise to the adipocyte phenotype. The delayed transactivation of the CEBPA and PPARG genes by CEBPB appears necessary to allow mitotic clonal expansion and thereby progression of terminal differentiation (PubMed:15985551, PubMed:17301242, PubMed:17601773, PubMed:20194620). Essential for female reproduction because of a critical role in ovarian follicle development (PubMed:9303532). Restricts osteoclastogenesis (PubMed:19440205). Together with NFE2L1; represses expression of DSPP during odontoblast differentiation (By similarity).[UniProtKB/Swiss-Prot Function]