Uba1 (NM_001276316) Mouse Untagged Clone

CAT#: MC229322

Uba1 (untagged) - Mouse ubiquitin-like modifier activating enzyme 1 (Uba1), transcript variant 3

USD 1,010.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Uba1 (NM_001276316) Mouse Untagged Clone
Symbol Uba1
Synonyms A1S9; Sbx; Ube-1; Ube1x
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC229322 representing NM_001276316
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCAGCTCGCCGCTGTCCAAGAAACGTCGCGTGTCCGGGCCTGATCCAAAGCCGGGTTCTAACTGCT
CCCCTGCACAGTCTGCGCTGTCCGAAGTGTCCTCAGTGCCAACCAACGGAATGGCGAAGAACGGCAGTGA
AGCAGACATAGACGAGAGCCTTTACTCCCGGCAGCTGTACGTTTTGGGCCATGAGGCAATGAAAATGCTC
CAGACATCCAGCGTCCTTGTCTCAGGCTTGCGGGGCTTGGGTGTAGAAATTGCTAAGAACATCATCCTTG
GTGGGGTCAAGGCTGTCACCCTACATGACCAAGGAACTACCCAGTGGGCTGATCTCTCCTCCCAGTTTTA
CCTTCGGGAGGAGGACATTGGTAAAAATCGAGCGGAGGTATCCCAGCCCCGACTTGCTGAACTCAACAGC
TATGTACCTGTCACTGCCTACACTGGGCCTCTTGTCGAGGACTTCCTTAGTAGCTTCCAGGTGGTGGTCC
TCACCAACAGCCCCCTGGAAGCCCAGCTGCGAGTGGGGGAGTTCTGTCATAGCCGTGGTATCAAGCTAGT
GGTGGCAGATACAAGAGGCCTGTTTGGGCAACTTTTCTGTGATTTTGGAGAGGAAATGGTCCTCACAGAT
TCCAATGGGGAGCAGCCACTCAGTGCTATGGTTTCAATGGTCACCAAGGACAACCCCGGTGTGGTTACCT
GCCTTGATGAGGCCCGACATGGCTTTGAGACTGGTGACTTCGTCTCATTCTCAGAAGTACAGGGCATGAT
CCAACTCAATGGATGTCAGCCCATGGAGATCAAAGTGCTGGGTCCTTATACCTTTAGTATCTGTGACACT
TCCAACTTCTCTGACTACATCCGTGGAGGCATCGTCAGTCAGGTCAAAGTACCGAAAAAGATTAGTTTTA
AATCCTTGCCAGCATCACTGGTAGAGCCTGACTTTGTGATGACTGACTTTGCCAAGTATTCTCGCCCTGC
CCAACTGCACATTGGCTTCCAAGCTCTGCACCAATTCTGTGCTCTGCACAACCAACCACCTCGACCACGA
AATGAGGAAGATGCAACAGAGCTGGTGGGCCTGGCTCAGGCTGTAAACGCTCGGTCCCCACCTTCAGTAA
AACAGAACAGCTTGGATGAAGACCTTATTCGGAAGCTAGCTTATGTTGCTGCTGGGGACCTGGCACCCAT
AAATGCTTTCATTGGGGGCCTTGCTGCCCAGGAAGTCATGAAGGCCTGCTCTGGAAAGTTTATGCCCATC
ATGCAGTGGTTGTACTTTGATGCTCTTGAATGTCTCCCAGAGGACAAAGAGGCTCTGACAGAGGAGAAGT
GCCTCCCACGTCAGAACCGTTACGATGGGCAGGTAGCTGTATTTGGGTCAGACTTTCAGGAGAAGCTGAG
CAAGCAAAAGTACTTCCTGGTGGGTGCAGGGGCCATTGGCTGTGAATTGCTCAAGAACTTTGCCATGATT
GGGCTGGGTTGTGGAGAGGGTGGAGAGGTCGTGGTCACAGACATGGACACCATTGAGAAATCAAATCTGA
ACCGACAGTTTCTCTTCCGGCCCTGGGATGTCACGAAGTTAAAGTCTGACACGGCCGCTGCAGCTGTGCG
CCAGATGAATCCTTACATCCAGGTGACAAGCCACCAGAACCGTGTAGGTCCTGACACTGAGCGCATCTAT
GATGATGATTTCTTCCAAAATTTGGATGGTGTGGCCAATGCTCTGGACAACATAGATGCCCGCATGTACA
TGGATCGCCGATGTGTGTACTATCGGAAGCCACTGCTAGAGTCTGGCACACTGGGCACAAAGGGCAACGT
GCAGGTGGTAATCCCCTTCCTGACAGAATCCTACAGCTCTAGCCAGGATCCACCAGAGAAATCCATCCCC
ATTTGTACCCTGAAAAACTTTCCCAATGCCATCGAACACACTCTTCAGTGGGCCCGGGATGAATTTGAAG
GCCTTTTCAAGCAGCCAGCAGAAAATGTTAATCAGTACCTCACAGACTCCAAATTTGTGGAGCGGACATT
GCGGCTGGCTGGTACCCAGCCATTGGAGGTGCTGGAGGCTGTGCAGCGCAGCCTGGTGTTGCAGCGACCA
CAGACTTGGGGAGACTGTGTGACCTGGGCCTGCCACCACTGGCACACCCAGTACTGTAACAACATCCGGC
AACTGCTGCACAACTTTCCTCCTGACCAGCTCACCAGCTCAGGGGCCCCTTTCTGGTCTGGACCCAAACG
CTGTCCACACCCACTTACTTTTGATGTTAACAATACATTGCATCTGGATTATGTGATGGCTGCTGCCAAC
CTTTTTGCCCAGACCTATGGGTTGACTGGATCCCAAGACCGAGCTGCTGTGGCCTCACTCCTGCAGTCAG
TACAAGTCCCAGAGTTCACCCCCAAGTCTGGTGTCAAGATTCATGTTTCTGACCAGGAGTTGCAGAGTGC
CAATGCCTCTGTTGATGACAGCCGTCTTGAGGAGCTCAAAGCCACATTGCCCAGCCCAGACAAGTTACCC
GGATTTAAGATGTACCCCATTGATTTTGAGAAGGATGATGACAGCAATTTCCACATGGATTTCATTGTGG
CTGCATCCAATCTTCGGGCCGAAAACTATGATATTTCCCCTGCAGACCGACACAAGAGCAAGCTGATTGC
AGGGAAGATCATCCCAGCCATTGCCACAACCACAGCTGCTGTGGTTGGCCTTGTGTGTCTGGAGCTCTAC
AAGGTAGTTCAAGGGCACCAACAGCTCGATTCCTACAAAAATGGTTTCCTGAACTTGGCCCTGCCCTTCT
TTGGGTTTTCTGAACCTCTTGCTGCACCTCGTCACCAGTACTATAATCAAGAGTGGACATTGTGGGATCG
CTTTGAAGTACAAGGGCTGCAGCCTAATGGTGAGGAGATGACCCTCAAGCAGTTCCTTGATTACTTTAAG
ACAGAGCACAAATTGGAGATCACCATGCTGTCCCAGGGCGTGTCCATGCTCTATTCTTTCTTCATGCCAG
CTGCTAAGCTCAAGGAACGATTGGATCAGCCGATGACAGAGATTGTGAGCCGAGTGTCAAAGAGAAAGCT
GGGCCGCCATGTGCGGGCACTGGTGCTTGAGCTGTGCTGCAACGATGAAAGCGGCGAGGACGTCGAGGTC
CCTTATGTCCGATATACCATTCGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001276316
ORF Size 3177 bp
Insert Size 3177
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001276316.1, NP_001263245
RefSeq Size 4165
RefSeq ORF 3177
Locus ID 22201
Cytogenetics X A1.3|X 16.15 cM
Gene Summary This gene encodes a member of the ubiquitin-activating E1 family. The encoded protein initiates the ubiquitin activation and transfer cascade, catalyzing the first step in ubiquitin conjugation to mark cellular proteins for proteasome degradation. Ubiquitin activating enzymes use ATP to form a thioester between a conserved catalytic cysteine of the enzyme and the C-terminal carboxylate of ubiquitin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.