Hgf (NM_001289461) Mouse Untagged Clone

CAT#: MC228773

Hgf (untagged) - Mouse hepatocyte growth factor (Hgf), transcript variant 5

USD 691.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Hgf (NM_001289461) Mouse Untagged Clone
Symbol Hgf
Synonyms C230052L06Rik; HGF/SF; NK1; NK2; SF; SF/HGF
Vector pCMV6-Entry
Sequence Data
>MC228773 representing NM_001289461
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGTGGGGGACCAAACTTCTGCCGGTCCTGTTGCTGCAGCATGTCCTCCTGCACCTCCTCCTGCTTC
ATGTCGCCATCCCCTATGCAGAAGGACAGAAGAAAAGAAGAAATACACTTCATGAATTTAAAAAGTCAGC
AAAAACTACTCTTACCAAGGAAGACCCATTACTGAAGATTAAAACCAAAAAAGTGAACTCTGCAGATGAG
TGTGCCAACAGGTGTATCAGGAACAGGGGCTTTACGTTCACTTGCAAGGCCTTCGTTTTTGATAAGTCAA
GAAAACGATGCTACTGGTATCCTTTCAATAGTATGTCAAGTGGAGTGAAAAAAGGGTTTGGCCATGAATT
TGACCTCTATGAAAACAAAGACTATATTAGAAACTGCATCATTGGTAAAGGAGGCAGCTATAAAGGGACG
GTATCCATCACTAAGAGTGGCATCAAATGCCAGCCTTGGAATTCCATGATCCCCCATGAACACAGCTATC
GCGGTAAAGACCTACAGGAAAACTACTGTCGAAATCCTCGAGGGGAAGAAGGGGGACCCTGGTGTTTCAC
AAGCAATCCAGAGGTACGCTACGAAGTCTGTGACATTCCTCAGTGTTCAGAAGTTGAATGCATGACCTGC
AATGGTGAAAGCTACAGAGGTCCCATGGATCACACAGAATCAGGCAAGACTTGTCAGCGCTGGGACCAGC
AGACACCACACCGGCACAAGTTCTTGCCAGAAAGATATCCCGACAAGGGCTTTGATGATAATTATTGCCG
CAATCCTGATGGCAAGCCGAGGCCATGGTGCTACACTCTTGACCCTGACACCCCTTGGGAGTATTGTGCA
ATTAAAACGTGCGCTCACAGTGCTGTGAATGAGACTGATGTCCCTATGGAAACAACTGAATGCATTCAAG
GCCAAGGAGAAGGTTACAGGGGAACCAGCAATACCATTTGGAATGGAATTCCCTGTCAGCGTTGGGATTC
GCAGTACCCTCACAAGCATGATATCACTCCCGAGAACTTCAAATGCAAGGACCTTAGAGAAAATTATTGC
CGCAATCCAGATGGGGCTGAATCACCATGGTGTTTTACCACTGACCCAAACATCCGAGTTGGCTACTGCT
CTCAAATTCCCAAGTGTGACGTGTCAAGTGGACAAGATTGTTATCGTGGCAATGGGAAAAATTACATGGG
CAACTTATCCAAAACAAGGTCTGGACTTACATGTTCCATGTGGGACAAGAATATGGAGGATTTACACCGT
CATATCTTCTGGGAGCCAGATGCTAGCAAATTGAATAAGAATTACTGCCGGAATCCTGATGATGATGCCC
ATGGACCTTGGTGCTACACGGGGAATCCTCTTATTCCTTGGGATTATTGCCCTATTTCCCGTTGTGAAGG
AGATACTACACCTACAATTGTCAATTTGGACCATCCTGTAATATCCTGTGCCAAAACAAAACAACTGCGG
GTTGTAAATGGCATTCCAACACAAACAACAGTAGGGTGGATGGTTAGTTTGAAATACAGAAATAAACATA
TCTGTGGAGGATCATTGATAAAGGAAAGTTGGGTTCTTACTGCAAGACAATGTTTTCCAGCCAGAAACAA
AGACTTGAAAGACTATGAAGCTTGGCTTGGCATCCACGATGTTCATGAGAGAGGCGAGGAGAAGCGCAAG
CAGATCTTAAACATTTCCCAGCTGGTCTATGGTCCTGAAGGCTCAGACTTGGTTTTACTGAAGCTTGCTC
GACCTGCAATCCTGGATAACTTTGTCAGTACAATTGATTTACCTAGTTATGGTTGTACAATCCCTGAAAA
GACCACTTGCAGTATTTACGGCTGGGGCTACACTGGATTGATCAACGCGGATGGTTTATTACGAGTAGCT
CATCTGTATATTATGGGGAATGAGAAATGCAGTCAGCACCATCAAGGCAAGGTGACTTTGAATGAGTCTG
AGTTATGTGCTGGGGCTGAAAAGATTGGATCAGGACCATGTGAGGGAGATTATGGTGGCCCACTCATTTG
TGAACAACACAAAATGAGAATGGTTCTTGGTGTCATTGTTCCTGGTCGTGGATGTGCCATCCCAAATCGT
CCTGGTATTTTTGTTCGAGTAGCATATTATGCAAAATGGATACACAAAGTAATTTTGACATACAAGTTGT
AA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001289461
ORF Size 2172 bp
Insert Size 2172
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001289461.1, NP_001276390
RefSeq Size 2645
RefSeq ORF 2172
Locus ID 15234
Cytogenetics 5 A3|5 7.07 cM
Gene Summary This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.