Txk (NM_001289495) Mouse Untagged Clone

CAT#: MC227868

Txk (untagged) - Mouse TXK tyrosine kinase (Txk), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Txk
• Synonyms: A130089B16Rik; Btkl; PTK-RL-18; PTK4; Rlk
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227868 representing NM_001289495
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCAAAACTCAATCCAACAGAGGCGGGGTGCAACCCTCGAAGCGCAAGCCGCTGCCCCCCCTCCCGC
  AGGAGCCTCCAGATGAGAGAATCCAGGTCAAGGCTCTTTATGACTTCCTGCCTCGGGAGCCTGGTAATTT
  GGCACTGAAGAGAGCGGAGGAATATCTGATATTGGAGAGGTGTGATCCTCACTGGTGGAAGGCCAGAGAC
  CGCTTCGGGAATGAAGGCTTAATCCCAAGCAACTATGTGACAGAAAACAGACTCGCCAACTTAGAAATCT
  ATGAATGGTACCACAAGAACATTACGAGAAACCAGACCGAACGCCTATTGAGGCAAGAGGCTAAAGAAGG
  TGCCTTTATCGTGAGAGATTCGAGACACTTGGGGTCTTACACAATCTCTGTGTTTACAAGAGCTCGAAGG
  CATACACAGTCTTCAATAAAACATTATCAGATAAAAAAGAATGACTCCGGACAGTGGTACATCACCGAAA
  GACATCTCTTCCCCTCAGTCCCCGAGTTGATCCAGTATCACCAGTACAATGCAGCTGGTCTCATATCTCG
  TCTCCGCTATCCCATTGGGCTCCTGGGCAGCTGTTTACCAGCCACATCTGGTTTTAGCTATGAAAAGTGG
  GAGATAGATCCATCAGAGTTGGCTTTTGTCAAGGAGATCGGAAGTGGTCAGTTTGGGGTTGTCCACTTAG
  GAGAATGGAGAGCACATATCCCGGTCGCCATCAAGGCCATCAATGAAGGTTCCATGTCTGAAGAAGACTT
  CATTGAGGAAGCCAAGGTGATGATGAAACTGTCACATTCGAGGTTAGTTCAACTTTACGGGGTGTGTATA
  CAGCAGAAGCCCCTGTACATAGTGACGGAGTTCATGGAGAACGGCTGCCTGCTTGACTATCTCAGGGAGA
  GGAAAGGCCAGCTTCAGAAGGCGCTGCTCTTGAGCATGTGCCAAGACATATGTGAAGGGATGGCGTACCT
  GGAGAGGAGCTGCTATATTCACAGGGATCTGGCTGCCAGGAACTGTTTGGTCAGTTCTGCCTGCGTAGTA
  AAGATCTCAGACTTCGGCATGGCGAGGTATGTTTTGGACGATGAATATATCAGTTCTTCTGGAGCTAAGT
  TCCCAGTCAAGTGGTGCCCACCTGAAGTCTTTCATTTCAACAAATACAGTAGCAAGTCTGATGTCTGGTC
  GTTCGGAGTTTTAATGTGGGAAGTTTTTACAGAAGGAAAAATGCCTTTTGAAAATAAGTCAAATTTGCAA
  GTGGTGGAAGCCATTTCTCAAGGTTTCCGGCTGTATCGTCCTCACCTGGCCCCCATGACCATATACAGAG
  TGATGTACAGTTGCTGGCATGAGAGCCCTAAAGGCCGTCCGACATTTGCTGAGCTGCTTCAGGTTCTCAC
  GGAGATCGCAGAAACGTGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289495
• Insert Size: 1422 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289495.1, NP_001276424.1
• RefSeq Size: 2277 bp
• RefSeq ORF: 1422 bp
• Locus ID: 22165
• UniProt ID: P42682
• Cytogenetics: 5 38.44 cM
• Gene Summary: Non-receptor tyrosine kinase that plays a redundant role with ITK in regulation of the adaptive immune response. Regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. When antigen presenting cells (APC) activate T-cell receptor (TCR), a series of phosphorylation lead to the recruitment of TXK to the cell membrane, where it is phosphorylated at Tyr-420. Phosphorylation leads to TXK full activation. Contributes also to signaling from many receptors and participates in multiple downstream pathways, including regulation of the actin cytoskeleton. Like ITK, can phosphorylate PLCG1, leading to its localization in lipid rafts and activation, followed by subsequent cleavage of its substrates. In turn, the endoplasmic reticulum releases calcium in the cytoplasm and the nuclear activator of activated T-cells (NFAT) translocates into the nucleus to perform its transcriptional duty. With PARP1 and EEF1A1, TXK forms a complex that acts as a T-helper 1 (Th1) cell-specific transcription factor and binds the promoter of IFNG to directly regulate its transcription, and is thus involved importantly in Th1 cytokine production. Phosphorylates both PARP1 and EEF1A1. Phosphorylates also key sites in LCP2 leading to the up-regulation of Th1 preferred cytokine IL-2. Phosphorylates 'Tyr-201' of CTLA4 which leads to the association of PI-3 kinase with the CTLA4 receptor.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) uses two alternate splice sites in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus than isoform 1.